Skip to main content
. Author manuscript; available in PMC: 2021 Jun 7.
Published in final edited form as: Mol Cell. 2020 Dec 28;81(3):599–613.e8. doi: 10.1016/j.molcel.2020.11.047

KEY RESOURCES TABLE.

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
Rabbit anti-MDA-5 antibody (D74E4) Cell Signaling Technology Cat# 5321; RRID: AB_10694490
Rabbit anti-MDA5 antibody (AT113) Enzo Life Sciences Cat# ALX-210-935-C100; RRID: AB_2264475
Rabbit anti-RIG-I antibody (AT111) Enzo Life Sciences Cat# ALX-210-932-C100; RRID: AB_2253427
Rabbit anti-TRIM14 antibody (ab185349) abcam Cat# ab185349
Mouse anti-TRIM25 antibody BD Biosciences Cat# 610570; RRID: AB_397919
Mouse TRIM26 antibody Santa Cruz Cat# sc-393832
Rabbit anti-TRIM41 antibody (ab111580) abcam Cat# ab111580; RRID: AB_10866520
Mouse anti-Strep Tag antibody (GT661) Invitrogen Cat# MA5-17283; RRID: AB_2538749
Anti-rabbit IgG-HRP Cell Signaling Technology Cat# 7074; RRID: AB_2099233
Anti-mouse IgG-HRP GE Healthcare Cat# NA931V; RRID: AB_772210
Anti-FLAG-HRP Sigma-Aldrich Cat# A8592
Rabbit anti-HA tag Cell Signaling Technology Cat# 3724S
Rabbit anti-myc tag Cell Signaling Technology Cat# 2278S
Rabbit anti-TRIM65 Invitrogen Cat# PA5-54459
Rabbit anti-STING Cell Signaling Technology Cat# 13647S
Rabbit anti-actin Cell Signaling Technology Cat# 8457L
Chemicals, peptides, and recombinant proteins
In-Fusion HD Takara Cat# 638909
Polyethylenimine Polyscience Cat# 23966-1
mammalian protease inhibitor cocktail G-Biosciences Cat# 786-433
anti-FLAG M2 agarose beads Sigma-Aldrich Cat# A2220
3X FLAG peptide Sigma-Aldrich Cat# F4799
Zeba desalting column, 40 kDa molecular-weight cutoff Thermo Fisher Scientific Cat# 87766
HyClone SFX Insect cell culture media GE Healthcare Cat# SH30278.02
Ni-NTA agarose QIAGEN Cat# 30250
HRV 3C protease Homemade N/A
HiTrap Heparin GE Healthcare Cat# 17040601
Superdex 200 Increase 10/300 GE Healthcare Cat# 28990944
Strep-Tactin Superflow IBA Cat# 2-1206-025
Ulp1 protease Homemade N/A
HiTrap Q GE Healthcare Cat# 17505301
Resource Q GE Healthcare Cat# 17117701
Resource S GE Healthcare Cat# 17117801
Superdex 75 Increase 10/300 GE Healthcare Cat# 29148721
Recombinant mouse E1 Cadena et al., 2019 N/A
Recombinant human Ubc13 Cadena et al., 2019 N/A
Recombinant human Uev1A Cadena et al., 2019 N/A
Recombinant human Ubiquitin (WT/K63R/K48R) Cadena et al., 2019 N/A
Cy5-labeled dsRNA This paper N/A
Calf intestinal alkaline phosphatase New England BioLabs Cat# M0290
Bis-Tris native PAGE Life Technologies BN1003BOX
Glutathione Magnetic Beads Pierce 88821
glutathione Sigma-Aldrich G4251
C-flat Holey Carbon 400 mesh copper grid (CF-1.2/1.3) Electron Microscopy Sciences CF413-50
Carbon Support Film 400 mesh copper grids Electron Microscopy Sciences CF400H-CU
peptide (LPETGG) conjugated with fluorescein Anaspec Custom synthesized
Lipofectamine 2000 Thermo Fisher Cat# 11668027
polyIC Invivogen Cat# tlrl-pic
TRIzol reagent Thermo Fisher Cat# 15596026
Direct-zol RNA Miniprep Kits Zymo Research Cat# R2050
High Capacity cDNA reverse transcription kit Applied Biosystems Cat# 4368814
SYBR Green Master Mix Applied Biosystems Cat# 4309155
DMEM, high glucose, pyruvate Cellgro Cat# 10-013-CV
Mammalian protease arrest GBiosciences Cat# 786-433
Critical commercial assays
Bac-to-Bac baculovirus expression systems Invitrogen Cat# A11098
Deposited data
TRIM65PSpry-MDA5-dsRNA Filament coordinates This study PDB: 7JL2
TRIM65PSpry-MDA5-dsRNA Filament EM map This study EMDB: 22370
TRIM65PSpry-MDA5-dsRNA Monomer coordinates This study PDB: 7JL0
TRIM65PSpry-MDA5-dsRNA Monomer EM map This study EMDB: 22368
RIPLETPSpry-RIG-I-dsRNA Filament coordinates This study PDB: 7JL3
RIPLETPSpry-RIG-I-dsRNA Filament EM map This study EMDB: 22371
RIPLETPSpry-RIG-I-dsRNA Monomer coordinates This study PDB: 7JL1
RIPLETPSpry-RIG-I-dsRNA Monomer EM map This study EMDB: 22369
TRIM65PSpry coordinates and map This study PDB: 7JL4
Experimental models: cell lines
HEK293T (WT and TRIM65 KD) This paper N/A
HEK293T (Cas9-stable) Laboratory of Dr. George Church Chavez et al., 2015
HEK293T (WT, RIG-I KO, and RIPLET KO) Laboratory of Dr. Fajian Hou Shi et al., 2017
Experimental models: organisms/strains
E. coli Rosetta 2(DE3) Novagen Cat# 71397-3
Oligonucleotides
TRIM65-specific guide RNA (Forward: TGCCGAGCGCCTCAAGCGCG) This paper N/A
TRIM65-specific guide RNA (Reverse: CGCGCTTGAGGCGCTCGGCA) This paper N/A
Human IFN-β qPCR primer (Forward: AAACTCA TGAGCAGTCTGCA) This paper N/A
Human IFN-β qPCR primer (Reverse: AGGAGA TCTTCAGTTTCGGAGG) This paper N/A
Human 18S qPCR primer (Forward: CGGCGACGACCCATTCGAAC) This paper N/A
Human 18S qPCR primer (Reverse: GAATCGAACCCTGATTCCCCGTC) This paper N/A
Recombinant DNA
pFastBac1 Invitrogen Cat# 10360014
pFastBac1-LGP2 This study N/A
pFastBac1-TRIM65CC-PSpry This study N/A
pE-SUMO Kan vector LifeSensors Cat# 1001K
pE-SUMO-MDA5 This study N/A
pE-SUMO-MDA5ΔN This study N/A
pE-SUMO-RIG-IΔN This study N/A
pE-SUMO-TRIM65PSpry-MDA5ΔN This study N/A
pE-SUMO-MDA5ΔN-TRIM65PSpry This study N/A
pE-SUMO-RIPLETPSpry-RIG-IΔN This study N/A
pE-SUMO-TRIM14CC-PSpry This study N/A
pE-SUMO-N-His6-Strep-TRIM25 CC This study N/A
pE-SUMO-N-His6-Strep-TRIM25 PSpry This study N/A
pE-SUMO-N-His6-Strep-TRIM25 CC-PSpry This study N/A
pE-SUMO-N-His6-Strep-TRIM26 PSpry This study N/A
pE-SUMO-N-His6-Strep-TRIM26 CC-PSpry This study N/A
pE-SUMO-N-His6-Strep-TRIM41 CC This study N/A
pE-SUMO-N-His6-Strep-TRIM41 PSpry This study N/A
pE-SUMO-N-His6-Strep-TRIM41 CC-PSpry This study N/A
pGEX-6P-1 GE healthcare Cat# 28954648
pGEX-N-His6-MDA5 helicase This study N/A
pGEX-N-His6-MDA5 α1 This study N/A
pGEX-N-His6-MDA5 Hel2i2 This study N/A
pGEX-N-His6-LGP2 Hel2i2 This study N/A
pGEX-N-His6-Dicer Hel2i2 This study N/A
pGEX-N-His6-TRIM65PSPry This study N/A
pGEX-N-His6-RIPLETPSPry This study N/A
pGEX-N-His6-TRIM14PSPry This study N/A
pGEX-N-His6-TRIM16PSPry This study N/A
pGEX-N-His6-TRIM47PSPry This study N/A
pGEX-N-His6-DDX41Hel12 This study N/A
pGEX-N-His6-DDX41Hel1 This study N/A
pGEX-N-His6-DDX41Hel2 This study N/A
pMal-c2x NEB N/A
pMal-N- His6-TRIM65PSpry This study N/A
pcDNA4-STINGV155M Laboratory of Dr. Philip J. Kranzusch N/A
Software and algorithms
XDS Kabsch, 2010 http://xds.mpimf-heidelberg.mpg.de
Phyre 2 Kelley et al., 2015 http://www.sbg.bio.ic.ac.uk/~phyre2/html/page.cgi?id=index
PHENIX Liebschner et al., 2019 https://www.phenix-online.org
COOT Emsley et al., 2010 https://www2.mrc-lmb.cam.ac.uk/personal/pemsley/coot/
RELION (version 3.08/3.1) Zivanov et al., 2018 https://www3.mrc-lmb.cam.ac.uk/relion//index.php?title=Main_Page
MotionCor2 Zheng et al., 2017 https://emcore.ucsf.edu/ucsf-software
CTFFIND 4.1 Rohou and Grigorieff, 2015 https://grigoriefflab.umassmed.edu/ctffind4
CueMol N/A http://www.cuemol.org/ja/
UCSF Chimera Pettersen et al., 2004 https://www.cgl.ucsf.edu/chimera/