REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
CMPK2 (Western Blotting)	Abcam	Cat# Ab194567
CMPK2 (Confocal Microscopy)	GeneTex	Cat# GTX31502
CMPK2 (Western Blotting)	ATLAS	Cat# HPA041430, RRID:AB_10796674
DENV NS1	Genetex	Cat# GTX1033, RRID:AB_1240703
DENV NS2B	Genetex	Cat# GTX124246, RRID:AB_11170698
DENV NS3	Genetex	Cat# GTX629477, RRID:AB_2801283
Flag	Sigma	Cat# F1804, RRID:AB_262044
β-actin	Genetex	Cat# GTX109639, RRID:AB_1949572
Tom20	Abcam	Cat# ab186734, RRID:AB_2716623
α-tubulin	Novus	Cat# NB100-690, RRID:AB_521686
TLR-9	Abcam	Cat# ab53396, RRID:AB_883065
8-OHdG	Millipore	Cat# AB5830, RRID:AB_92060
IL-1β	Cell signaling	Cat# 12242, RRID:AB_2715503
CKR-7(4B12)FITC-(Mus musculus)	Santa Cruz	Cat# sc-57074, RRID:AB_782012
normal rat IgG-FITC	Santa Cruz	Cat# sc-2340, RRID:AB_737200
CCR7 (Homo sapiens)	BD PharMingen	Cat# 550937, RRID:AB_393968
STAT1	Santa Cruz	Cat# sc-592, RRID:AB_632434
pSTAT1	Epitomics	Cat# 2825-1, RRID:AB_2198144
NFκB p65	Santa Cruz	Cat# sc-109, RRID:AB_632039
Phospho-NF-κB p65 (Ser536)	Cell signaling	Cat# 3031, RRID:AB_330559
Purified Mouse IgM, λ Isotype Control	BD PharMingen	Cat# 550963, RRID:AB_393980
Goat IgG isotype control	Genetex	Cat# GTX35039, RRID:AB_10623176
PE Armenian Hamster IgG Isotype Ctrl	Biolegend	Cat# 400907, RRID:AB_326593
FITC Mouse IgG2a, κ Isotype Ctrl (FC)	Biolegend	Cat# 341051, RRID:AB_400209
FITC anti-mouse I-Ak (Aβk) (MHC class II)	Biolegend	Cat# 109905, RRID:AB_313454
Donkey anti-Goat IgG (H+L), Alexa Fluor 488	Thermo Fisher Scientific	Cat# A-11055, RRID:AB_2534102
Goat anti-Mouse IgG, Alexa Fluor 488	Thermo Fisher Scientific	Cat# A-11001, RRID:AB_2534069
Goat anti-Rabbit IgG (H+L), Alexa Fluor 594	Thermo Fisher Scientific	Cat# A-11012, RRID:AB_141359
Goat anti-Rabbit IgG (H+L), Alexa Fluor 647	Thermo Fisher Scientific	Cat# A27040, RRID:AB_2536101
GFP	Genetex	Cat# GTX113617, RRID:AB_1950371
PE anti-mouse CD11c	Biolegend	Cat# 117307, RRID:AB_313776
Bacterial and virus strains
DENV2 strain New Guinea C	provided by Dr. YL Lin	N/A
DENV1	provided by Dr. YL Lin	N/A
DENV3	provided by Dr. YL Lin	N/A
DENV4	provided by Dr. YL Lin	N/A
Chemicals, peptides, and recombinant proteins
MitoSOX	Thermo Fisher Scientific	Cat# M36008
Mitotracker deep red FM	Invitrogen	Cat# M22426
Cell Counting Kit-8 (CCK-8)	Dojindo	Cat# CK04
Ponceau S	Sigma	Cat# P7170
LPS	InvivoGen	Cat# tlrl-3pelp
ATP	Sigma	Cat# A6419
Lipofectamine 3000	Thermo Fisher Scientific	Cat# L3000001
FAM-FLICA® Caspase-1 Assay Kit	Immunochemistry technologies	Cat# 97
Human GMCSF	R&D systems	215-GM
Human recombinant IL-4	R&D systems	204-IL
Mouse GMCSF	PeproTech	Cat#31503
Mouse MCSF	PeproTech	Cat#31502
Recombinant Human IFN-α	PBL Assay Science	Cat#11100-1
Recombinant mouse IFN-α	PBL Assay Science	Cat#12100-1
Recombinant Human CCL19/MIP-3β	R&D systems	Cat#361-MI-025
Recombinant Murine CCL19/MIP-3β	PeproTech	Cat#250-27B
ELISA Human IFN-α	PBL Assay Science	Cat#41100-1
ELISA Human IFN-λ1	R&D systems	Cat#DY7246
Human IL-1β Antibody (ELISA)	R&D systems	Cat# MAB601, RRID:AB_358545
Human IL-1β Biotinylated Antibody (ELISA)	R&D systems	Cat# BAF201, RRID:AB_356214
Recombinaant Human IL-1β Antibody (ELISA)	R&D systems	Cat# 201-LB
ELISA Human TNF-α	R&D system	Cat#DY210 , RRID:AB_2848160
Human CD14+ microbeads	Miltenyi Biotec	Cat#130-050-201, RRID:AB_2665482
Ruxolitinib	Invivogen	Cat#tlrl-rux
BMS-986165	MedChemExpress	Cat#HY-117287
AG490	TOCRIS	Cat#0414
STAT3 inhibitor V	Calbiochem	Cat#573099
PD985059	Calbiochem	Cat#513000
SB203580	Calbiochem	Cat#559399
SP600125	Calbiochem	Cat#420119
LY294002	Sigma-Aldrich	Cat#L9908
BAY11-7082	Calbiochem	Cat#196870
Deposited data
Gene microarray data	This report	GEO:GSE172293
Experimental models: Cell lines
A549	Bioresource Collection and Research Center, Taiwan	Cat# 60074, RRID:CVCL_0023
THP-1	ATCC	Cat# TIB-202, RRID:CVCL_0006
HEK293T	Gift from RNAi core, Academic Sinica, Taipei, Taiwan	N/A
Experimental models: Organisms/strains
C57BL/6J	National Laboratory Animal Breeding and Research Center (Taipei, Taiwan)	Stock number: RMRC11005
C57BL/6J Ifnar-/-	From Dr. Guann-Yi Yu (National Health Research Institute (NHRI), Taiwan)	N/A
C57BL/6J Stat1-/-	from Dr. Chien-Kuo Lee (National Taiwan University, Taiwan)	N/A
Oligonucleotides
siRNA CMPK2 (Homo sapiens) GACCCAGUCAGUGGCAGAUUCACUU	Invitrogen	Cat#HSS151614
siRNA CMPK2 (Mus musculus ) GGCAGUACUUGACCUAGUU	MDBIO, INC	N/A
sgRNA CMPK2 (Homo sapiens) GCCCTGGCTCACTTCGCCCT	Academia Sinica RNAi core	N/A
Primers for qPCR, see Table S1	This study	N/A
Recombinant DNA
TMPK2-GFP (CMPK2-GFP)	Gift from Dr. Chang, Zee-Fen	N/A
PUC-GFP		N/A
pcDNA3.1-Mouse CMPK2-DYK	GenScript. Inc. (Piscataway, NJ)	Cat#OMu15173
pcDNA3.1-DYK
Lenti-pLKO_AS3w.puro	Academia Sinica RNAi core	N/A
Lenti-pLKO_AS3w.puro-DYK	This study	N/A
Lenti-pLKO_AS3w.puro-mCmpk2-DYK	This study	N/A
Software and algorithms
GraphPad Prism 7.0 software	GraphPad Software	http://www.graphpad.com/
Image J	NIH	https://imagej.nih.gov/ij/
FlowJo	FlowJo software	https://www.flowjo.com/