KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| CD36 (western blotting) | Abcam | Cat# Ab133625, RRID:AB_2716564 |
| CD36 (confocal microscopy) | Santa Cruz Biotechnology | Cat# Sc7309, RRID:AB_627044 |
| CAV1 | CLOUD-CLONE | Cat# PAA214Mu01 |
| FABP3 | Abcam | Cat# Ab16916, RRID:AB_443553 |
| PPAR | Cell Signaling Technology | Cat# 2443, RRID:AB_823598 |
| PPAR | Santa Cruz Biotechnology | Cat# Sc7273, RRID:AB_628115 |
| GAPDH | Sigma | Cat# G9545, RRID:AB_796208 |
| Tubulin | Santa Cruz Biotechnology | Cat# Sc8035, RRID:AB_628408 |
| SIRT6 | Cell Signaling Technology | Cat# 12486, RRID:AB_2636969 |
| VLDLR | Santa Cruz Biotechnology | Cat# Sc18824, RRID:AB_2216805 |
| H3 | Cell Signaling Technology | Cat# 4260, RRID:AB_1904005 |
| H3K9AC | Cell Signaling Technology | Cat# 9649, RRID:AB_823528 |
| Acetylated lysine | Cell Signaling Technology | Cat# 9681s, RRID:AB_331799 |
| Acetylated lysine | Cell Signaling Technology | Cat# 9814s, RRID:AB_10544700 |
| H3K56AC | Millipore | Cat# 07-677-1, RRID:AB_390167 |
| FLAG | Sigma | Cat# F7425, RRID:AB_439687 |
| anti-rabbit HRP | Cell Signaling Technology | Cat# 7074, RRID:AB_2099233 |
| anti-mouse HRP | Cell Signaling Technology | Cat# 7076, RRID:AB_330924 |
| Normal rabbit IgG | Cell Signaling Technology | Cat# 2729, RRID:AB_1031062 |
| Donkey anti-mouse, alexa fluor 488 | Thermo Fisher Scientific | Cat# A-21202, RRID:AB_141607 |
| Goat anti-rabbit, alexa fluor 546 | Thermo Fisher Scientific | Cat# A-11035, RRID:AB_143051 |
| Clean-blot IP detection reagent | Thermo Fisher Scientific | Cat# 21230, RRID:AB_2864363 |
| Bacterial and virus strains | ||
| Ad null | Vector Biolab | Cat# 1300 |
| Ad-SIRT6 (human) | Vector Biolab, Adenovirus | Cat# 1556 |
| Chemicals, peptides, and recombinant proteins | ||
| Hoechst 33342 | Thermo Fisher Scientific | Cat# H3570 |
| BODIPY-C1,C-12 | Thermo fisher Scientific | Cat# D3823 |
| BODIPY 493/503 | Thermo fisher Scientific | Cat# D3922 |
| GW9662 | Cayman | Cat# 70785 |
| Rosiglitazone | Sigma-Aldrich | Cat# 122320-73-4 |
| Complete, mini protease inhibitor Cocktail | Sigma-Aldrich | Cat# 11836170001 |
| Critical commercial assays | ||
| Clarity ECL western blotting substrate | BioRad | Cat# 1705061 |
| Clarity max western ECL substrate | BioRad | Cat# 1705062 |
| Surebeads protein G | BioRad | Cat# 161-4023 S |
| Protein G magnetic beads | Cell Signaling Technology | Cat# 70024s |
| cDNA synthesis kit | BioRad | Cat# 1708890 |
| SYBR green-PCR mix | BioRad | Cat# 1725121 |
| SYBR green-PCR mix | TAKARA | Cat# RR820 |
| Lipofectamine 2000 transfection reagent | Thermo Fisher Scientific | Cat# 11668019 |
| Lipofectamine RNAiMAX transfection reagent | Thermo Fisher Scientific | Cat# 13778150 |
| Lipofectamine 3000 transfection reagent | Thermo Fisher Scientific | Cat# L3000015 |
| Horse serum, heat inactivated | Thermo Fisher Scientific | Cat# 26050088 |
| Fetal bovine serum | Thermo Fisher Scientific | Cat# 10500064 |
| Antibiotic-Antimycotic mixture | Thermo Fisher Scientific | Cat# 15240062 |
| ProLong gold antifade mountant with DAPI | Thermo Fisher Scientific | Cat# P36931 |
| Deposited data | ||
| RNA-Seq | Etchegaray et al., 2019 | GEO: GSE130690 |
| ChIP-Seq | Etchegaray et al., 2019 | GEO: GSE130689 |
| ChIP-Seq -K562 Cells | Dunham et al., 2012 | ENCSR000AUB |
| ChIP-Seq -H1 Cells | Dunham et al., 2012 | ENCSR000AUS |
| SIRT6 structure | Pan et al., 2011 | 3pki |
| PPARg structure | Chandra et al., 2008 | 3e00 |
| Human reference genome NCBI build 37, GRCh37 | Genome Reference Consortium | https://www.ncbi.nlm.nih.gov/grc/human |
| Experimental models: cell lines | ||
| HEK293T | ATCC | Cat# CRL-3216, RRID:CVCL_0063 |
| HeLa | ATCC | Cat# CRM-CCL-2, RRID:CVCL_0030 |
| Experimental models: organisms/strains | ||
| Mouse: SIRT6 ± | The Jackson Laboratory | RRID:IMSR_JAX:006050 |
| Mouse: db/db | The Jackson Laboratory | RRID:IMSR_JAX:000697 |
| Mouse: C57BL/6J | The Jackson Laboratory | RRID:IMSR_JAX:000664 |
| Oligonucleotides | ||
| Primer sequences | Please see Table S2 | N/A |
| SIRT6 siRNA (RAT) GCAUCUCAAUGGUUCCUAU | Ravi et al., 2019 | N/A |
| SIRT6 siRNA (Human) AAGAAUGUGCCAAGUGUAAGA | Ravi et al., 2019 | N/A |
| Control siRNA AAUUCUCCGAACGUGUCACGU | Ravi et al., 2019 | N/A |
| Recombinant DNA | ||
| SIRT6 Flag | North et al., 2003 | Addgene Cat #13817, RRID:AB_13817 |
| SIRT6 Flag-H133Y | Ravi et al., 2019 | N/A |
| SIRT6 Flag-S56Y | Ravi et al., 2019 | N/A |
| SIRT6 Flag-D188A | This study | N/A |
| Pparg Flag | Hauser et al., 2000 | Addgene Cat# 8895, RRID:AB_8895 |
| Pparg DNA binding domain flag | This study | N/A |
| Cd36 promoter luciferase | This study | N/A |
| Software and algorithms | ||
| ImageJ | Schneider et al., 2012 | https://imagej.nih.gov/ij/ |
| CONSURF | Ashkenazy et al., 2016 | https://consurf.tau.ac.il/ |
| HADDOCK | van Zundert et al., 2016 | https://wenmr.science.uu.nl/ |
| HDOCK | Yan et al., 2017 | http://hdock.phys.hust.edu.cn/ |
| ModLoop | Fiser and Sali, 2003 | https://modbase.compbio.ucsf.edu/modloop/ |
| FoldX | Schymkowitz et al., 2005 | http://foldxsuite.crg.eu/ |
| Lasagna | Lee and Huang, 2013 | https://biogrid-lasagna.engr.uconn.edu/lasagna_search/index.php |
| Other | ||
| ChemiDoc touch imaging system | BioRad | N/A |
| QuantStudio 6 flex RealTime PCR system | Thermo Fisher Scientific | N/A |
| LSM 880 confocal microscope | Carl Zeiss | N/A |
| BIORUPTOR PICO | DIAGENODE | N/A |
| Hybond PVDF membrane | Amersham | N/A |