Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
qPCR primers used in this study
| Target | Primers | Sequence (5' to 3') | Tm (˚C) | % GC | amplicon size (bp) |
|---|---|---|---|---|---|
| Forward and reverse primers targeting whiB7 (BB28_RS17590) | WhiB7_qPCR_F4 | ACTTTCCGCGAACCACAG | 55.6 | 55.6 | 81 |
| WhiB7_qPCR_R1a | ATGATGACCGTCGAAGTGG | 54.6 | 52.6 | ||
| Forward and reverse primers targeting 16s rRNA (BB28_RS07070) | Myco_16S_F1 | CCGGATAGGACCACACACTT | 56.6 | 55 | 91 |
| Myco_16S_R1 | ATTACCCCACCAACAAGCTG | 55.4 | 50 |
