KEY RESOURCES TABLE.
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Anti-mouse Ly6G clone 1A8 BUV395 | BD | Cat# 563978 RRID:AB_2716852 |
| Anti-mouse CD24 clone M1/69 BUV496 | BD | Cat# 564664 RRID:AB_2716853 |
| Anti-mouse CD19 clone 1D3 BUV737 | BD | Cat# 564296 RRID:AB_2716855 |
| Anti-mouse CD8 alpha clone 53.6–7 BUV800 | BD | Cat# 564920 RRID:AB_2716856 |
| Anti-mouse CD8 alpha clone 53.6–7 BB700 | BD | Cat# 566409 RRID:AB_2744467 |
| Anti-mouse MHCII M5/114.15.2 BV421 | BD | Cat# 562564 RRID:AB_2716857 |
| Anti-mouse CD11c clone N418 BV605 | BioLegend | Cat# 117334 RRID:AB_2562415 |
| Anti-mouse CD11c clone N418 APC | BioLegend | Cat# 117310 RRID:AB_313779 |
| Anti-mouse CD4 clone RM4–5 BV650 | BD | Cat# 563747 RRID:AB_2716859 |
| Anti-mouse/human CD11b M1/70 BV711 | BD | Cat# 563168 RRID:AB_2716860 |
| Anti-mouse/human CD11b M1/70 BB515 | BD | Cat# 564454 RRID:AB_2665392 |
| Anti-mouse CD45 30-F11 BV785 | BD | Cat# 564225 RRID:AB_2716861 |
| Anti-mouse CD69 H½F3 FITC | BioLegend | Cat# 104506 RRID:AB_313109 |
| Anti-mouse CD3 epsilon clone 17A2 PerCP-Cy5.5 | BD | Cat# 560527 RRID:AB_1727463 |
| Anti-mouse PDCA-1 clone 927 PE | BioLegend | Cat# 127010 RRID:AB_1953285 |
| Anti-mouse CD49b clone DX5 PE-Dazzle | BioLegend | Cat# 108924 RRID:AB_2565271 |
| Anti-mouse CD103 clone 2E7 PE-Cy7 | BioLegend | Cat# 121426 RRID:AB_2563691 |
| Anti-mouse F4/80 clone BM8 APC | BioLegend | Cat# 123116 RRID:AB_893481 |
| Anti-mouse Ly6C clone HK1.4 APC-Cy7 | BioLegend | Cat# 128026 RRID:AB_10640120 |
| Anti-mouse CXCL9 PE | BioLegend | Cat# 515604 RRID:AB_2245489 |
| Anti-mouse TIM-3 clone RMT3–23 PE | BioLegend | Cat# 119703 RRID:AB_345377 |
| Anti-mouse TIM-3 clone RMT3–23 FITC | ThermoFisher | Cat# 11–5870-82 RRID:AB_2688129 |
| Anti-mouse P2X7R clone 1F11 PE | BioLegend | Cat# 148703 RRID:AB_2650951 |
| Anti-mouse Galectin-9 clone 108A2 APC | BioLegend | Cat# 137912 RRID:AB_2750155 |
| Anti-mouse Galectin-9 clone RG9–35 PE | BioLegend | Cat# 136103 RRID:AB_1953306 |
| Anti-FLAG clone L5 PE | BioLegend | Cat# 637310 RRID:AB_2563148 |
| Anti-mouse CD16/CD32 clone 2.4G2 (Fc block) | BD | Cat# 553142 RRID:AB_394657 |
| Anti-mouse CD3 epsilon clone 145–2C11 biotin | BioLegend | Cat# 100304 RRID:AB_312669 |
| Anti-mouse/human B220 clone RA3–6B2 biotin | BioLegend | Cat# 103204 RRID:AB_312989 |
| Anti-mouse Ly6G clone 1A8 biotin | BioLegend | Cat# 127604 RRID:AB_1186108 |
| Anti-mouse CD49b clone DX5 biotin | BioLegend | Cat# 108904 RRID:AB_313411 |
| Anti-mouse Ter119 clone TER-119 biotin | BioLegend | Cat# 116204 RRID:AB_313705 |
| Anti-mouse TIM-3 clone RMT3–23 (LEAF) | BioLegend | Cat# 119708 RRID:AB_2564109 |
| Anti-mouse/human HMGB1 clone 3E8 (Ultra-LEAF) | BioLegend | Cat# 651414 RRID:AB_2728488 |
| Anti-human/mouse GAPDH (polyclonal) | ThermoFisher | Cat# PA1–16777 RRID:AB_568552 |
| Donkey anti-rabbit IgG (polyclonal) Alexa 488 | ThermoFisher | Cat# A21206 RRID:AB_2535792 |
| Anti-human/mouse phospho TBK1/NAK (Ser172) (D52C2) XP Rb mAb | Cell signaling | Cat# 5483 RRID:AB_10693472 |
| Anti-human/mouse TBK1/NAK (D1B4) Rb mAb | Cell signaling | Cat# 3504 RRID:AB_2255663 |
| Anti-human/mouse phospho IRF3 (Ser396) (D6O1M) Rb mAb | Cell signaling | Cat# 29047 RRID:AB_2773013 |
| Anti-human/mouse IRF3 (D83B9) Rb mAb | Cell signaling | Cat# 4302 RRID:AB_1904036 |
| Anti-mouse Cgas (D3O8O) Rb mAb | Cell signaling | Cat# 31659S RRID:AB_2799008 |
| Anti-human/mouse STING (D2P2F) Rb mAb | Cell signaling | Cat# 13647S RRID:AB_2732796 |
| Anti-mouse/human nuclear matrix protein p84 (5E10) | Abcam | Cat# Ab487 RRID:AB_304696 |
| Anti-mouse/human β-actin | Millipore-Sigma | Cat# A2228 RRID:AB_476697 |
| Anti-mouse/human Vinculin | Millipore-Sigma | Cat# V9131 RRID:AB_477629 |
| Anti-rabbit IgG HRP linked | Millipore-Sigma | Cat# NA934V RRID:AB_2722659 |
| Anti-mouse IgG HRP linked | BioLegend | Cat# 405306 RRID:AB_315009 |
| Anti-GAPDH mAb (GA1R) | ThermoFisher | Cat# MA5–15738 RRID:AB_10977387 |
| Goat anti-Rabbit IgG (H+L), DyLight 800 4X PEG | ThermoFisher | Cat# SA5–35571 RRID:AB_2556775 |
| Goat anti-Mouse IgG (H+L), DyLight 680 | ThermoFisher | Cat# 35519 RRID:AB_1965956 |
| Polyclonal goat anti-fluorescein, Alexa 488 | ThermoFisher | Cat# A11096 RRID:AB_221558 |
| Anti-mouse TIM-3 clone RMT3–23 | BioXCell | Cat# BE0115 RRID:AB_10949464 |
| Anti-mouse TIM-3 clone RMT3–23 (mouse IgG2a) | TESARO: A GSK Company | N/A |
| Anti-mouse TIM-3 clone RMT3–23 (mouse IgG1-D265A) | TESARO: A GSK Company | N/A |
| Anti-mouse Galectin-9 clone RG9–1 | BioXCell | Cat# BE0218 RRID:AB_2687702 |
| Anti-mouse IFNAR1 clone MAR1–5A3 | BioXCell | Cat# BE0241 RRID:AB_2687723 |
| Rat anti-HRPN Isotype Control (IgG1) | BioXCell | Cat# BE0088 RRID:AB_1107775 |
| Rat anti trinitrophenol Isotype Control (IgG2a) | BioXCell | Cat# BE0089 RRID:AB_1107769 |
| Anti-human CD45 clone H130 BV785 | BD | Cat# 563716 RRID:AB_2716864 |
| Anti-human HLA-DR clone L243 APC-Fire750 | BioLegend | Cat# 307658 RRID:AB_2572101 |
| Anti-human CD16 clone 3G8 BV421 | BD | Cat# 562874 RRID:AB_2716865 |
| Anti-human CD3 epsilon clone OKT3 PerCP710 | ThermoFisher (eBioscience) | Cat# 46–0037-42 RRID:AB_1834395 |
| Anti-human CD56 clone HCD56 BB700 | BD | Cat# 555518 RRID:AB_398601 |
| Anti-human CD19 clone SJ25C1 BB700 | BD | Cat# 566396 RRID:AB_2744310 |
| Anti-human CD11c clone 3.9 BV650 | BioLegend | Cat# 301638 RRID:AB_2563797 |
| Anti-human CD14 clone M5E2 BUV805 | BD | Cat# 565779 RRID:AB_2716868 |
| Anti-human CD11b clone ICRF44 BUV395 | BD | Cat# 563839 RRID:AB_2716869 |
| Anti-human BDCA1/CD1c clone F10/21A3 BB515 | BD | Cat# 565054 RRID:AB_2716870 |
| Anti-human BDCA3/CD141 clone M80 APC | BioLegend | Cat# 344106 RRID:AB_10899578 |
| Anti-human CD123 clone 6H6 BV650 | BioLegend | Cat# 306020 RRID:AB_2563827 |
| Anti-human CXCL9 clone J1015E10 | BioLegend | Cat# 357904 RRID:AB_2562009 |
| Anti-human CXCL10 clone J034D6 PE | BioLegend | Cat# 519504 RRID:AB_2561409 |
| Anti-human TIM-3 clone F38–2E2 (Ultra-LEAF) | BioLegend | Cat# 345009 RRID:AB_11150398 |
| Anti-human TIM-3 clone TSR-022 | TESARO: A GSK Company | N/A |
| Anti-human TIM-3 clone TSR-A7 | TESARO: A GSK Company | N/A |
| Bacterial and Virus Strains | ||
| N/A | ||
| Biological Samples | ||
| Adult peripheral blood mononuclear cells | OneBlood | N/A |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Paclitaxel | Alvogen | 47781–59307-0 |
| Human Flt-3L-Ig | BioXCell | Cat# BE0098 |
| Recombinant mouse IFNγ | Peprotech | Cat# 315–05 |
| Recombinant mouse GM-CSF | Peprotech | Cat# 315–03 |
| 2’3’-cGAMP | InvivoGen | Cat# tlrl-nacga23 |
| 3’3’-cGAMP | InvivoGen | Cat# tlrl-nacga |
| DMXAA | InvivoGen | Cat# tlrl-dmx |
| Poly(dA:dT) rhodamine (synthetic B-DNA analog) | InvivoGen | Cat# tlrl-patrh |
| Recombinant mouse IFNα | BioLegend | Cat# 751802 |
| Recombinant mouse IFNβ1 | BioLegend | Cat# 581302 |
| Recombinant mouse HMGB1 | BioLegend | Cat# 764004 |
| Zombie NIR Fixable Viability Kit | BioLegend | Cat# 423105 |
| TrueStain FcX Block | BioLegend | Cat# 422302 |
| Brefeldin A (1000x solution) | BioLegend | Cat# 420601 |
| Monensin (1000x solution) | BioLegend | Cat# 420701 |
| Recombinant mouse galectin-9 | R&D Systems | Cat# 3535-GA-050 |
| Recombinant mouse TIM-3-Fc | R&D Systems | Cat# 1529-TM-050 |
| D-Lactose monohydrate | Sigma-Aldrich | Cat# 61339 |
| Diphtheria Toxin | Sigma-Aldrich | Cat# D0564 |
| Polybrene infection/transfection reagent | Sigma-Aldrich | TR-1003-G |
| Collagenase A | Millipore Sigma | 11088793001 |
| DNAse I, grade II from bovine pancreas | Roche | 10104159001 |
| Matrigel GFR/LDEV-Free | ThermoFisher | Cat# CB-40230 |
| Live/Dead Fixable Aqua Dead Cell Stain | ThermoFisher | Cat# L34957 |
| Hygromycin B | ThermoFisher | Cat# 10–687-010 |
| FastDigest Esp3l | ThermoFisher | Cat# FD0454 |
| AccuCheck Counting Beads | ThermoFisher | Cat# PCB100 |
| polyethylenimine 25kDa (PEI) transfection reagent | Polysciences | Cat# 23966–2 |
| Dynasore, dynamin inhibitor I, CAS 30448–55-3 | Millipore-Sigma | Cat# 324410 |
| Ciliobrevin D, dynein inhibitor | Millipore-Sigma | Cat# 250401 |
| Critical Commercial Assays | ||
| Single Tube TaqMan Gene Expression Assays | ThermoFisher Scientific | Cat# 4331182 |
| nCounter Mouse Pan-Cancer Immune Panel | NanoString | XT-CSO-MIP1–12 |
| nCounter Human Pan-Cancer Immune Panel | NanoString | XT-CSO-HIP1–12 |
| Click-iT EdU Cell Proliferation Kit Alexa 594 | Invitrogen | Cat# C10339 |
| NE-PER Nuclear and Cytoplasmic Extraction Reagent | ThermoFisher | Cat# 78833 |
| In-Fusion HD cloning kit | TakaraBio | Cat# 638909 |
| Nucleospin PCR/Gel purification kit | TakaraBio | Cat# 740609.5 |
| Nucleospin Plasmid miniprep | TakaraBio | Cat# 740588.5 |
| PureLink HiPure Plasmid Midiprep kit | ThermoFisher | Cat# K210004 |
| pHrodo Red Transferrin Conjugate | ThermoFisher | Cat# P35376 |
| pHrodo Deep Red E. coli BioParticles | ThermoFisher | Cat# P35360 |
| Deposited Data | ||
| N/A | ||
| Experimental Models: Cell Lines | ||
| MDA-MB-231 | ATCC | Cat# HTB-26 RRID:CVCL_0062 |
| PyMT-B6 | David G. DeNardo, Washington University | Meyer et al. Nat. Commun. 2018 PMID: 29593283 |
| LentiX-239T | Takara Bio | Cat# 632180 |
| Experimental Models: Organisms/Strains | ||
| Mouse: B6.FVB-Tg(MMTV-PyVT)634Mul/J | The Jackson Laboratory | RRID: IMSR_JAX:022974 |
| Mouse: B6.Cg-Tg(Itgax-cre)1–1Reiz/J | The Jackson Laboratory | RRID: IMSR_JAX:008068 |
| Mouse: BC(Cg)-Irf8tm1.1hm/J | The Jackson Laboratory | RRID: IMSR_JAX:014175 |
| Mouse: B6(Cg)-Xcr1tm2(HBEGF/Venus)Ksho (Xcr1-DTR) | Matthew Krummel, UCSF | RRID: IMSR_RBRC09485 |
| Mouse: B6(Cg)-Tmem173tm1.2Camb/J | The Jackson Laboratory | RRID: IMSR_JAX:025805 |
| B6.129P2(SJL)-Myd88tm1.1Defr/J | The Jackson Laboratory | RRID: IMSR_JAX:009088 |
| C57BL/6J-Ticam1Lps2/J | The Jackson Laboratory | RRID: IMSR_JAX:005037 |
| B6(C)-Cgastm1d(EUCOMM)Hmgu/J | The Jackson Laboratory | RRID: IMSR_JAX:026554 |
| B6;129-Mavstm1Zjc/J | The Jackson Laboratory | RRID: IMSR_JAX:008634 |
| Mouse: C57BL/6J | The Jackson Laboratory | RRID: IMSR_JAX:000664 |
| Oligonucleotides | ||
| Non-targeted (GGACATTACATATAAGACCA) | Integrated DNA Technology | N/A |
| Mb21d1 (CGGGCCGCAGCTTTCCGCGT) | Integrated DNA Technology | N/A |
| Tmem173 (CAGTAGTCCAAGTTCGTGCG) | Integrated DNA Technology | N/A |
| Recombinant DNA | ||
| lentiCRISPRv2 hygro | Addgene | Cat# 98291 RRID:Addgene_98291 |
| pCMV VSV-G | Addgene | Cat# 8454 RRID:Addgene_8454 |
| psPAX2 | Addgene | Cat# 12260 RRID:Addgene_12260 |
| pET28a-Flag-HMGB1–6xHIS | Addgene | Cat# 53561 RRID:Addgene_53561 |
| Software and Algorithms | ||
| FlowJo Version 9 and 10 | FlowJo LLC |
https://www.flowjo.com RRID:SCR_008520 |
| Prism Version 8 | GraphPad |
https://www.graphpad.com/scientific-software/prism/ RRID:SCR_002798 |
| Other | ||
| Mouse anti-human IgG (Fc) Coated Polystyrene Particles (10.0–14.0 μm) | Spherotech | Cat# HUAMP-100–4 |
| MojoSort Streptavidin Nanobeads | BioLegend | Cat# 480016 |