Skip to main content
NCBI home page
Food Science & Nutrition logoLink to Food Science & Nutrition
. 2021 Mar 29;9(6):2894–2907. doi: 10.1002/fsn3.2246

Maca extracts regulate glucose and lipid metabolism in insulin‐resistant HepG2 cells via the PI3K/AKT signalling pathway

Aimin Li 1,2, Jia Liu 3,4, Fangli Ding 3,4, Xiaolei Wu 2, Cong Pan 3,4, Qing Wang 3,4, Ming Gao 3,4, Shenglin Duan 3,4, Xiaofeng Han 3,4, Kai Xia 3,4, Shiwei Liu 3,4, Yimin Wu 3,4, Zhiqiao Zhou 3,4, Xi Zhang 5, Xiao‐Dong Gao 1,✉
PMCID: PMC8194906  PMID: 34136157

Abstract

This work focused on the separation of the active ingredients of maca (Lepidium meyenii Walpers) and evaluated the antioxidative capability of these components with effects on improving glucose and lipid metabolism in insulin‐resistant HepG2 cells. DPPH free radical scavenging and reducing power assays were used to evaluate the antioxidant activity of maca extracts. An insulin‐resistant HepG2 cell model induced by glucose, fructose, oleic acid, and palmitic acid was adopted to investigate the effects of maca extracts on regulating glucose and lipid metabolism in this study. LC‐MS/MS was then used for determination of the maca n‐butanol (NBT) subfraction. The results showed that maca ethanol extract and subfractions of this extract exhibited certain antioxidant capacity. Furthermore, the NBT subfraction reversed the disorders in glucose and lipid metabolism in insulin‐resistant HepG2 cells and significantly increased the mRNA expression of phosphoinositide 3‐kinases (PI3K) and AKT in insulin‐resistant HepG2 cells in a dose‐dependent manner. In addition, the LC‐MS/MS results showed that the NBT subfraction contained many active ingredients. Overall, this study suggests that the NBT subfraction of the ethanol extract rich in glucosinolates modulates insulin resistance via PI3K/AKT activation in insulin‐resistant HepG2 cells and might exert potentially beneficial effects in improving or treating glucose and lipid metabolic disorders.

Keywords: AKT, glucose and lipid metabolism, Maca ethanol extracts, PI3K

This work focused on the separation of Maca (Lepidium meyenii Walp.) active ingredients, and evaluated the antioxidative capability of these components with the effects on improving glucose and lipid metabolism in insulin resistant HepG2 cells.

graphic file with name FSN3-9-2894-g007.jpg

1. INTRODUCTION

Diabetes mellitus refers to a group of chronic metabolic diseases characterized by high‐blood sugar and has become a worldwide epidemic. According to the latest report published by the International Diabetes Federation in 2019, 463 million adults (aged 20–79 years) are currently living with diabetes mellitus worldwide, and it has been estimated that 578.4 million people will be suffering from diabetes mellitus and complications in 2030 (International Diabetes Federation, 2019). Type 2 diabetes mellitus, which is the most common, accounting for approximately 90% of cases, and harmful to human health (Shi & Hu, 2014), is characterized by insulin resistance (Castillo et al., 2012) and might cause many severe chronic complications, such as cardiovascular disease, neuropathy, nephropathy, and retinopathy (Schram et al., 2014). Therefore, effective prevention and treatment is critical for type 2 diabetes. At present, the clinical drugs for type 2 diabetes treatment mainly include metformin, alpha glucosidase inhibitors, sulfonylureas, thiazolidinediones, and meglitinides, and all of these drugs have a number of side effects. Therefore, the identification of a safer and more effective method for alleviating type 2 diabetes is necessary. Type 2 diabetes is closely related to lifestyle, and dietary intervention is considered an effective alternative method for alleviating or treating diabetes. The development of functional foods that can alleviate insulin resistance is of great importance in clinical settings and would have fewer side effects than drugs. In recent years, natural products have been widely investigated, and the active ingredients in some edible plants have been proven to enhance the metabolism of glucose and lipids through free radical scavenging and inflammation improvements (Eid et al., 2017; Shen et al., 2019).

Lepidium meyenii Walpers, which is known as maca, is widely cultivated in the central highlands of the Peruvian Andes and China and was approved as a novel food by the Chinese government in 2011 (Hao et al., 2014). Maca has attracted widespread attention due to its function in sexual improvement, fertility enhancement, antioxidant activity, antifatigue activity, and memory impairment (Choi et al., 2012; Uchiyama et al., 2014), which are closely related to the natural active ingredients contained in maca. Maca is not only rich in polysaccharides, tannins, fat oils, branched amino acids, and other components but also contains some secondary metabolites, such as glucosinolates, macaamide, macacene, glucosinolates, flavonoids, terpenes, and sterols. Some studies have found that feeding a certain amount of maca to diabetic rats could decrease the levels of lipids and glucose in the blood (Vecera et al., 2007). The report showed the protective effects of maca against type 2 diabetes, but the specific mechanism through which maca regulates insulin resistance is not very clear. Therefore, exploring the mechanism through which maca alleviates insulin resistance is of great importance. The phosphoinositide 3‐kinase (PI3K)/AKT and AMP‐activated protein kinase (AMPK) signalling pathways play critical roles in regulating glucose metabolism in insulin‐resistant cells (Hardie, 2004). PI3K/AKT is a major downstream molecular pathway of insulin (Hardie, 2004). The activation of AMPK switches off anabolic pathways that consume adenosine triphosphate (ATP), such as glycogen, and switches on catabolic pathways that generate ATP, such as glycolysis (Steinberg & Kemp, 2009).

In the present study, we investigated the effects of different subfraction from maca extracts in regulating glucose metabolism in insulin‐resistant HepG2 cells and explored the active ingredients that might play a key role in regulating insulin resistance. The key genes and signal transduction pathways involved in improving glucose metabolism were also analyzed in this study. We obtained the n‐butanol subfraction of maca ethanol extract and provided the first clarification of its effects on regulating glucose and lipid metabolism in insulin‐resistant HepG2 cells. More importantly, this work can be helpful for further understanding the underlying mechanism through which maca regulates glucose and lipid metabolism.

2. MATERIALS AND METHODS

2.1. Chemicals and drugs

Black maca was purchased from a farm in Yunnan Province of New Era Health Industry (Group) Co., Ltd. Phosphate‐buffered saline (PBS), Hank's balanced salt solution (HBSS), bovine serum, Dulbecco's modified Eagle's medium (DMEM), and glucose‐free DMEM were purchased from Gibco Life Technologies; oleic acid (OA), palmitic acid (PA), 1,1‐diphenyl‐2‐picrylhydrazyl (DPPH, 90%), dimethyl sulfoxide (DMSO), 3‐[4,5‐dimethylthiazol‐2‐yl]‐2,5‐diphenylterazolium bromide (MTT), oil red O staining agent, trypsin, rutin standard, and macaamide standard were purchased from Sigma; fatty acid‐free bovine serum albumin (BSA) was provided by WAKO; RIPA lysate and TG, glucose assay and glycogen assay kits were procured from Nanjing Jiancheng Bioengineering Institute; and ethanol, petroleum ether, ethyl acetate, and n‐butanol were purchased from Sinopharm Chemical Reagent Co., Ltd. All other chemicals and solvents, all of which were of analytical grade, were obtained from China.

2.2. Fractional extraction of maca

Dried black maca was powdered using a Philips Juicer (Zhuhai Special Economic Zone Philips Home Appliances Co., Ltd.) and sifted through a 100‐mesh sieve. Maca powder was extracted twice with 75% (v/v) ethanol at a solid–liquid ratio of 1:15 (w/v) under sonication for 30 min at 50°C. The mixture was then centrifuged at 400 g, and the supernatant was collected. Ethanol was removed by decompression distillation at 40°C using an IKA® RV 10 instrument (Zhengzhou Changchengke Industry and Trade Co., Ltd), and maca ethanol extract (MEE) was collected. MEE was further extracted successively with petroleum ether, ethyl acetate, and water‐saturated n‐butanol, and the extracts remaining in the aqueous phase were dried using an LGJ‐18 Vacuum freeze dryer (Beijing SongyuanHuaxing Technology Development Co., Ltd.). Finally, maca subfractions of the petroleum ether phase (PE), maca ethyl acetate phase (EA), maca n‐butanol phase (NBT), and maca aqueous phase (WAT) were obtained.

2.3. Antioxidant capacity assay

The scavenging capacity of free radicals was evaluated using the DPPH test as described previously for maca extracts (Zevallos‐Concha et al., 2016). The ability of maca extracts to scavenge DPPH radicals was measured by the discoloration of the solution (Mensor et al., 2001). Briefly, 1.0 ml of the extracts at concentrations of 0–5.0 mg/ml were mixed with 1.0 ml of DPPH methanol solution. The mixtures were then incubated for 30 min in the dark at room temperature, and the absorbance was measured with a spectrophotometer at 517 nm. The reading was performed against a blank without maca extract. The data are expressed as percentages of the scavenging capacity of free radicals determined using the DPPH test.

The ferric reducing antioxidant power (FRAP) assay was used to measure the total antioxidant power (Benzie & Szeto, 1999). In brief, 1.0 ml of 0.2 M PBS at pH 6.6, 1.0 ml of 1% potassium ferricyanide solution and 1.0 ml of extract solution were added to 5.0‐ml test tubes, and the mixture was shaken and immediately heated in a water bath at 50°C for 20 min. Subsequently, 1.0 ml of 10% trichloroacetic acid was added, and the test tube was cooled to room temperature and then shaken. The mixed solution was centrifuged for 10 min at 200 g, and 2.0 ml of the supernatant was then removed and mixed with 3.0 ml of distilled water and 0.2 ml of 0.1% ferric chloride. The mixture was allowed to stand for 10 min, and the absorbance was measured at 725 nm using distilled water as the control treatment.

2.4. Cell culture and sample preparation

HepG2 cells were supplied by Peking Union Medical College Hospital, Chinese Academy of Medical Sciences. The culture was maintained in 10% FBS in DMEM containing 1% antibiotic antimycotic solution (100×) at 37°C in an incubator with a humidified atmosphere and 5% CO2. The extracts were dissolved in DMSO, diluted with DMEM, and then filtered through a 0.22‐μm Millipore membrane prior to their use for the treatment of HepG2 cells. The final concentration of DMSO did not exceed 0.1% of the culture media in all the experiments (Liu et al., 2014).

2.5. Cell viability assay

HepG2 cells (1 × 105 cells/well) were grown in 96‐well plates with different concentrations of the maca extracts for 24 hr. After 24 hr, the medium was replaced with 20 μl of MTT solution (5 mg/ml), and the cells were incubated for another 4 hr at 37°C. The medium containing MTT was then carefully removed to avoid disturbing the formation of mazan crystals. DMSO was added, and the absorbance at 490 nm was recorded using a Spectro Max i3 microplate reader (MD Electronics). The cell viability was expressed as a percentage relative to that of the control group without maca extracts.

2.6. Establishment of insulin‐resistant HepG2 cell line model

Previous studies have shown that free fatty acids, such as oleic acid and palmitic acid, can induce fat accumulation in HepG2 cells (Chen & Wu, 2005; Marinković et al., 2019), and the combination of glucose, fructose, and free fatty acids (FFAs) could successfully induce metabolic disorders in HepG2 cells, including dyslipidemia, insulin resistance, hyperuricemia, and oxidative stress (Zhao et al., 2016). Therefore, a cell model that featured insulin resistance was established by treatment with glucose (G) and fructose (F) plus FFA in this study, and the best combination was selected based on the analysis of several different treatment groups. First, the cells (3.5 × 106) were grown in a 96‐well plate in high‐glucose DMEM with 10% FBS. After 24 hr, the medium was replaced with DMEM containing glucose, fructose and FFAs at different concentrations (10G + 15F + 1FFA, 10G + 15F + 2FFA, 10G + 25F + 1FFA, 10G + 25F + 2FFA, 20G + 15F + 1FFA, 20G + 15F + 2FFA, 20G + 25F + 1FFA, 20G + 25F + 2FFA), and cells grown in serum‐free DMEM containing 1% BSA served as the control group (Li et al., 2018). The group name 20G + 15 F + 1FFA indicates treatment with 20 mM glucose, 15 mM fructose and 1 mM FFA, which is a mixture of oleic acid, palmitic acid and BSA at a molar ratio of 4.4:2.2:1.

2.7. Glucose uptake assay

After 24 hr of treatment with the maca extracts, HepG2 cells were washed and cultured in DMEM containing 12.5 mM glucose. The glucose concentration in the medium was determined using a glucose assay kit (Nanjing Jiancheng Bioengineering Institute). The amount of glucose consumption was calculated using the initial glucose level and the glucose level remaining in the medium (So et al., 2016; Zhang et al., 2017). In addition, a standard antidiabetic drug, metformin (30 μM), was used as a positive control.

2.8. Intracellular glycogen assay

The culture medium was removed after 24 hr of treatment with the maca extracts, and the HepG2 cells were then washed with PBS and dissolved in RIPA lysis buffer. The glycogen concentration in the cell was determined using a glycogen assay kit.

2.9. Intracellular and supernatant TG assay

The culture medium was removed after 24 hr of treatment with the maca extracts, and the intracellular and supernatant TG levels were detected using the TG kit according to the instructions (Zhang et al., 2013).

2.10. Oil Red O staining

The cells were washed with PBS and fixed with 75% freshly prepared ethanol for 10 min. The fixed cells were washed three times with water and then stained with Oil Red O solution for 10 min. The excess stain was removed, and the stained cells were dried completely, observed under a light microscope and photographed (Yoon et al., 2013).

2.11. LC‐MS/MS analysis

The NBT fraction was analyzed using an LCMS‐9030 (Shimadzu) equipped with a Shim‐pack GIST‐C18 column (2 μm, 2.1 mm × 100 mm). Water containing 0.1% formic acid (A) and acetonitrile (B) were used as the elution solvents. The elution program was the following: 0–2 min, 5% B; and 2–10 min, 5%–25% B. The flow rate was 0.2 μl/min, and the sample loading was 2 μl. A full MS scan was used with m/z 50–1000. The MS parameters of MS were set as follows: spray voltage, 3.3 kV; capillary temperature, 320°C; heater temperature, 350°C; auxiliary gas flow, 8.0 L/min; sheath gas flow rate, 32.0 L/min; sweep gas, 4.0 L/min; and S‐lens RF level, 50%.

2.12. Quantitative real‐time PCR (qRT‐PCR)

Total RNA from HepG2 cells was prepared with TRIzol (Invitrogen) and an RNeasy kit following the manufacturer's instructions. cDNA was synthesized using a QuantiTect Reverse Transcription kit (Qiagen) with 2 μg of total RNA and amplified using SYBR Premix Ex Taq and gene‐specific primers with a Takara Thermal Cycler Dice Real‐Time system (40 cycles of 95°C for 5 s, 58°C for 10 s, and 72°C for 20 s). The primers included PI3K (forward 5′‐CTATCCAGACCAGTACGTTCG‐3′, and reverse 5′‐GAGGGCACAATCAAGAAAAGG‐3′), AKT (forward 5′‐TCTATGGCGCTGAGATTGTG‐3′, and reverse 5′‐TCTTAATGTGCCCGTCCTTG‐3′), and GAPDH (forward 5′‐TTCTGGGATACACGGAGCAC‐3′, and reverse 5′‐TACCAGCACCAGCGTCAAAG‐3′). Once the reactions were completed, a melting curve was constructed to confirm that the amplification was successful. The data were analyzed using Opticon Monitor software (ver. 3.1; Bio‐Rad Laboratories).

2.13. Statistical analysis

The data are presented as the means ± standard deviations (SDs) from at least three replicates of each sample. The statistical analyses were performed using SPSS 20.0 software (SPSS Inc.). The data were analyzed by one‐way ANOVA, and p <.05 indicated significant differences.

3. RESULTS

3.1. Results from the screening for antioxidant capacity in vitro

As depicted in Figure 1, increases in the concentration of maca extracts in the range of 0.2–5 mg/ml gradually increased the inhibition rate of DPPH. In addition, PE exhibited the most significant DPPH inhibition ability (IC 50 = 1.68 mg/ml). The radical scavenging activity of PE might be due to the presence of macaamide. Table 1 shows the total antioxidant ability of maca extracts compared with that of the standard rutin. Different maca extracts showed different antioxidant activities, ranging from 0.77 ± 0.07 for WAT to 3.21 ± 0.04 mg rutin/g for the NBT fraction. These results indicated that maca alcohol extract had potential antioxidant capacity, which was consistent with previous research (Feng et al., 2010).

FIGURE 1.

FIGURE 1

Open in a new tab

DPPH inhibition rates obtained with different concentrations of the samples. Subfractions: MEE, maca ethanol extract; PE, petroleum ether; EA, ethyl acetate; NBT, n‐butanol; and WAT, water

TABLE 1.

Antioxidant capacity of different Maca extracts in vitro

Maca extracts DPPH scavenging a IC50 (mg/ml) mg rutin/g maca extract b
MEE 4.53 1.91 ± 0.05
PE subfraction 1.68 0.96 ± 0.22
EA subfraction 2.14 0.41 ± 0.08
NBT subfraction 2.67 3.21 ± 0.04
WAT subfraction 4.84 0.77 ± 0.07
Open in a new tab

Abbreviations: EA, ethyl acetate; MEE, maca ethanol extract; NBT, n‐butanol; PE, petroleum ether; WAT, water.

a

DPPH radical scavenging ability of different maca extracts.

b

Total antioxidant power of different maca extracts measured using the FRAP assay.

3.2. Effect of MEE and subfractions of MEE on cell proliferation

The appropriate concentrations of subfractions of maca ethanol extract for cellular treatment were determined using the MTT assay. As shown in Figure 2, maca ethanol extract did not influence the viability of HepG2 cells at concentrations of 0–1 mg/ml. However, an MEE concentration higher than 1 mg/ml significantly decreased the cell viability rate.

FIGURE 2.

FIGURE 2

Open in a new tab

Effects of maca ethanol extract on cell viability. MEE: maca ethanol extract, *p < .05 compared with the control group

The PE, EA, NBT, and WAT fractions (0.1–0.2 mg/ml) did not influence the viability of HepG2 cells (Figure 3). At a concentration of at least 0.3 mg/ml, the PE, NBT, and WAT fractions significantly inhibited cell growth (p < .05). Thus, 0.2 mg/ml was selected as the highest concentration used for further experiments.

FIGURE 3.

FIGURE 3

Open in a new tab

Effects of maca ethanol extract subfractions on cell viability. Subfractions: PE, petroleum ether; EA, ethyl acetate; NBT, n‐butanol; and WAT, water. *p < .05 compared with the control group

3.3. Establishment of a metabolic disorder model of HepG2 cells

As presented in Figure 4, the glucose consumption of extracellular glucose was significantly lower in the 20G + 15F + 1FFA‐treated group than in the control group (p < .05). In addition, the extracellular triglyceride (ETG) and intracellular triglyceride (ITG) levels were significantly increased in almost all the treatment groups (p < .05). In particular, the ETG and ITG contents of the 20G + 15F + 1FFA‐treated group were approximately 2.6‐ and 1.2‐fold higher than those in the control group, respectively. Considering the three above‐mentioned indicators, the 20G + 15F + 1FFA group was selected to establish the model of glucose and fructose metabolism disorder.

FIGURE 4.

FIGURE 4

Open in a new tab

Establishment of the insulin resistance cell model. (a), Effect of supplementation with glucose, fructose and free fatty acids on glucose consumption in HepG2 cells. (b), Effect of supplementation with glucose, fructose and free fatty acids on the contents of extracellular triglycerides. (c) Effect of supplementation with glucose, fructose and free fatty acids on the contents of intracellular triglycerides. GLU, glucose consumption; ITG, intracellular triglyceride; ETG, extracellular triglyceride. *p < .05 compared with the control group

Furthermore, the cell model was verified by staining, and images of Oil red O‐stained cells treated with 20G + 15F + 1FFA are shown in Figure 5. Oleic acid clearly induced an increase in the cellular lipid content, as determined by a higher number of red lipid globules inside the treated cells than in the control cells. All of the above results indicated that the cell model of glucose and lipid metabolic disorder was successfully established.

FIGURE 5.

FIGURE 5

Open in a new tab

Images of Oil red O‐stained cells. 20G + 15 F + 1FFA: cells treated with 20 mM glucose, 15 mM fructose and 1 mM FFA; Control group: untreated cells

3.4. Effect of maca ethanol extract on glucose and lipid homeostasis

The effects of maca ethanol extract on regulating glucose and lipid metabolism are shown in Figure 6. The level of glucose consumption from the cell culture medium first increased and then decreased, and significant differences (p < .05) were found at concentrations of 100–200 μg/ml, which indicated that maca ethanol extract at concentrations of 100–200 μg/ml could promote glucose consumption. The intracellular TG level was significantly increased with the high concentration of maca ethanol extract, and the extracellular TG content in the group treated with maca ethanol extract at a concentration of 1,000 μg/ml was 65% higher than that in the model group. The results suggested that maca ethanol extract might improve disorders in glucose and lipid metabolism.

FIGURE 6.

FIGURE 6

Open in a new tab

Maca ethanol extract regulates glucose consumption in HepG2 cells. GLU, glucose consumption; ITG, intracellular triglyceride; ETG, extracellular triglyceride. *p < .05 compared with the model group

3.5. Effect of subfractions of maca ethanol extract on glucose and lipid homeostasis

A previous study (Gonzales, 2015) indicated that maca ethanol extract could reduce glycemia in mice, which suggests that the extract might exhibit insulin‐mimetic activity to enhance glucose consumption at the cellular level. To understand the potential roles of maca extracts in glucose metabolism, this study first examined their ability to regulate glucose consumption in HepG2 model cells. As shown in Figure 7, the NBT fraction at 10, 25, 50, 100, and 200 μg/ml dose‐dependently and significantly increased glucose consumption by 8%, 8%, 18%, 20%, and 22% in HepG2 cells, respectively, compared with the results obtained with the model group. The effect was similar to that produced by MET (positive control). PE, EA, and WAT at 10–200 μg/ml did not exert any effect. A previous study showed that glucosinolates and flavonoids in maca could improve the glucose absorption of insulin‐resistant cells (Zhang, 2017). The NBT fraction might contain active ingredients such as glucosinolates and flavonoids.

FIGURE 7.

FIGURE 7

Open in a new tab

Subfractions of maca ethanol extract regulate glucose consumption in HepG2 cells. Subfractions: PE, petroleum ether; EA, ethyl acetate; NBT, n‐butanol; and WAT, water. *p < .05 compared with the model group

We also investigated the effect of subfractions of maca ethanol extract on 25G + 15F + 1FFA‐induced triglyceride accumulation. The ITG contents are presented in Figure 8. Treatment with the NBT fraction significantly increased the ITG contents compared with those found in the model group (p <.05), which suggested that the NBT fraction could promote the synthesis of TG in insulin‐resistant HepG2 cells. In particular, the NBT fraction increased the TG content in a dose‐dependent manner within 10–200 μg/ml. It is well known that insulin can significantly improve the metabolism of glucose and lipids in the human body by promoting glucose consumption and fat and protein synthesis in cells (Saltiel & Kahn, 2001). Therefore, the increase in TG after the NBT treatment might be related to the promotion of glucose absorption and lipid synthesis. Furthermore, the increase in lipids in cells can reduce the effect of glucotoxicity and thus improve insulin resistance in cells (Howard, 1999). We could conclude that the NBT fraction can improve insulin resistance by regulating glucose and lipid metabolism. Many chemically synthesized statin drugs could improve lipid metabolism and promote human health (Liu et al., 2018). However, the consumption of statin drugs for a long time can have some side effects, such as diarrhea, muscle aches or pain, nausea, indigestion, and weakness (Beltowski et al., 2009). Maca extracts, as a type of natural bioactive compound, might have fewer side effects and be developed as potential agents for regulating glucose and lipid metabolism.

FIGURE 8.

FIGURE 8

Open in a new tab

Subfractions of maca ethanol extract regulate the ITG levels in HepG2 cells. Subfractions: PE, petroleum ether; EA, ethyl acetate; NBT, n‐butanol; and WAT: water. *p < .05 compared with the model group

The ETG contents are presented in Figure 9. Treatment with maca extracts significantly increased the ETG contents in all four treated groups compared with that in the model group (p < .05), which suggested that maca ethanol extract could improve the secretion of TG in insulin‐resistant HepG2 cells. In particular, the NBT fraction at a concentration of 200 μg/ml increased the ETG content by approximately 50%, and this effect was better than that obtained with 30 μM metformin. Metformin can stimulate glucose transport and utilization in cells and promote the synthesis of triglycerides in cells (Lenhard et al., 1997); thus, the NBT fraction might exert a similar effect as MET on regulating glucose consumption.

FIGURE 9.

FIGURE 9

Open in a new tab

Subfractions of maca ethanol extract regulate the ETG levels in HepG2 cells. Subfractions: PE, petroleum ether; EA, ethyl acetate; NBT, n‐butanol; and WAT, water. *p < .05 compared with the untreated group

3.6. LC‐MS/MS analysis

The phytochemical composition of the NBT fraction was further determined by LC‐MS/MS analysis in the positive mode. The total ion chromatogram (TIC) of the NBT fraction is shown in Figure 10. Supported by the fragment pattern (Table 2), the Spectral Database and previous reports (Long‐bo et al., 2017; Zhou et al., 2017), the corresponding compounds were initially determined. Eight representative peaks (Table 2) were tentatively identified as N‐(3,4‐dimethoxybenzyl)‐hexadecanamide (Wang, 2015), benzyl glucosinolate, (2R)‐2‐hydroxy‐2‐phenethylglucos, L‐phenylalanine, L‐tryptophan, N‐benzyl‐(9Z,12Z,15Z)‐octadecatrienamide), N‐benzyl‐(9Z,12Z)‐octadecadienamide; Xing Li & Chen, 2017), and N‐benzylhexadecanamide. The specific mass spectrum information is provided in the supplementary materials.

FIGURE 10.

FIGURE 10

Open in a new tab

Total ion chromatogram of the NBT fraction determined by UPLC‐Q‐TOF MS: (a) positive mode and (b) negative mode

TABLE 2.

Mass spectral data of the identified compounds in maca

Peak RT (min) [M + H]+ (m/z) MS2 (m/z) Molecular formula Identification
1 1.053 404.10445 174.9552 C23H67NO3 N‐(3,4‐dimethoxybenzyl)‐hexadecanamide
2 5.274 408.07479 96.9595 C14H19O9NS2 Benzyl glucosinolate
3 6.051 438.05297 96.9596 138.9700 250.0121 438.0526 C15H12N5O11 (2R)−2‐Hydroxy−2‐phenethylglucos
4 11.003 263.08543 114.0555 C5H11N8O5 unknown
5 15.309 255.09544 91.0537, 121.0647, 255.1488 C7H11N8O3 unknown
6 3.826 166.0862 77.0383, 120.0806 C9H11NO2 L‐Phenylalanine
7 5.29 188.07072 91.0538, 115.0543,118.0653 C12H13NO L‐Tryptophan
8 11.003 265.10045 70.0649 91.0540 116.0704 C21H13 unknown
9 11.174 307.18043 91.0539 121.0644 307.1804 C20H23N2O unknown
10 15.322 257.11041 91.0539 C7H13N8O3 unknown
11 19.897 277.21594 77.0382 91.0539 106.0695 119.0856 121.0645 147.1167 277.2159 C18H29O2 unknown
12 23.592 368.29441 91.0539 108.0805 368.2945 C25H37NO N‐benzyl‐(9Z, 12Z, 15Z)‐octadecatrienamide)
13 24.646 370.31003 91.0539 108.0805 190.1221 370.3096 C25H39NO N‐benzyl‐(9Z, 12Z)‐octadecadienamide)
14 25.567 346.31007 91.0539 346.3099 C23H39NO N‐benzylhexadecanamide
Open in a new tab

1–5 refer to mass spectral data obtained in the negative mode; 6–14 show mass spectral data obtained in the positive mode.

3.7. Gene expression analyses of the PI3K/AKT and AMPK signalling pathways

It is well known that insulin plays an important role in glucose homeostasis by accelerating glucose transport and consuming energy via PI3K/AKT (Schultze et al., 2012). The activation of PI3K leads to the activation of AKT, which is a central mediator of many metabolic and growth actions of insulin. This kinase has been identified as one of the kinases responsible for the inactivation of glycogen synthase kinase through phosphorylation. The activation of Akt also promotes the translocation of GLUT4 vesicles to the plasma membrane (Abdul‐Ghani & Defronzo, 2010). As shown in Figure 11, the gene expression of PI3K and AKT was analyzed in HepG2 cells with glucose and lipid metabolic disorders. Compared with the control group, the model group showed significantly decreased PI3K/AKT gene expression levels, which suggests that 25G + 10F + 1FFA can induce serine/threonine phosphorylation of the insulin receptor INSR and thus reduce the ability to activate P13K and weaken the signal transduction of the downstream insulin receptor GLUT4, and these effects result in abnormal glucose metabolism. Compared with the results obtained with the model group, the mRNA expression of PI3K and AKT in the NBT‐treated group was positively related to the concentration of the NBT fraction (p < .05), which indicated that the NBT fraction could regulate cell glucose metabolism by activating the PI3K pathway to promote AKT expression. This conclusion was consistent with the results from the analysis of glucose consumption described in Section 3.5. We can thus conclude that the NBT fraction activated the PI3K/AKT signalling pathway by increasing insulin sensitivity.

FIGURE 11.

FIGURE 11

Open in a new tab

Effect of the NBT‐treated cells on the PI3K (a) and AKT (b) mRNA levels. # p < .05 compared with the control group, *p < .05 compared with the model group

4. DISCUSSION

Natural products reportedly have multiple biological activities. In China, many types of natural plants are used as functional food and for clinical treatment (Bagherniya et al., 2018; Lee et al., 2020), but the lack of a clear definition of the active constituents and mechanisms of action of natural plants have limited their application. Maca (Lepidium meyenii Walpers) has been used as a dietary supplement and ethnomedicine for centuries. Recently, maca has become a high‐profile functional food worldwide due to its multiple biological activities, such as enhancing fertility and sexual performance (Perrone et al., 2007) and showing antifatigue (Yue et al., 2019) and antioxidant activity (Vecera et al., 2007). Previous in vivo studies have shown that maca can significantly improve glucose tolerance and decrease the level of TAG (triacylglycerols) in plasma (Vecera et al., 2007). The aqueous extract of black maca could prevent and improve high‐fat, high‐fructose diet (HFD)‐induced metabolic disorders in golden hamsters (Wenting et al., 2018).

Maca contains alkaloids, glucosinolates, sterols and other active components. This study provides the first assessment of the in vitro activity of maca ethanol extract, and the specific active components were also identified. We first found that the NBT phase of maca ethanol extract could regulate glucose and lipid metabolism, and this effect might be due to the identified active components, such as benzyl glucosinolate, in the NBT fraction. A previous report also showed that glucosinolates might play an important role in glucose and lipid metabolism (Miao et al., 2012), which is consistent with our results. In addition, we also proved that the other subfractions of MEE, such as the PE, EA, and WAT fractions, have no positive effect on improving glucose and lipid metabolism.

Diabetes is a common and complex disease with a long course, multiple complications and hard‐to‐heal characteristics (Duarte et al., 2019). Previous studies have indicated that insulin participates in the metabolism of glucose and lipids, and insulin resistance could reduce glucose consumption in the cells and induce abnormal lipid levels (Peppa et al., 2015). Insulin‐mediated glucose uptake has been found to be reduced by more than 50% in patients with type 2 diabetes mellitus, which is related to specific alterations in the insulin signal transduction pathway, such as the PI3K/AKT and AMPK signalling pathways. Insulin resistance will result in reduced PI3K activity or altered protein expression of the regulatory subunit of PI3K. For instance, rosiglitazone increases insulin‐stimulated glucose transport via the PI3K signalling pathway by regulating the expression and activation of PI3K and AKT (Park et al., 2008). In addition, many active ingredients, including β‐sitosterol, mango tree leaf extracts, p‐coumaric acid and rosemary (Rosmarinus officinalis L.) extract, could improve glucose and lipids via the AMPK signalling pathway (Hwang et al., 2008; Yoon et al., 2013; Zhang et al., 2013). 1 Wenting Wan found that aqueous extract of black maca could prevent metabolic disorders by regulating the glycolysis/gluconeogenesis‐TCA cycle and PPARα signalling activation (Li et al., 2018). In our study, we first investigated maca alcohol extract and identified the n‐butanol‐graded active components by tracking their activity. We then found that the NBT fraction could improve glucose and lipid metabolism in insulin‐resistant cells by regulating the APK and PI3K signalling pathways.

Many studies have researched the regulation of glucose and lipid metabolism by natural products, but few studies studied maca. Maca glucosinolate can exert hypoglycemic effects (Guzman‐Perez, 2014), but the mechanism is not very clear. Some studies have preliminarily proven that maca glucosinolates could regulate the insulin resistance status and then improve glucose metabolism (Zhang, 2017). Thus, the compounds in the NBT fraction identified in our study, namely, benzyl glucosinolate and (2R)‐2‐hydroxy‐2‐phenethylglucos, might be the main active ingredients that could increase insulin sensitivity and exhibit the above‐mentioned biological activity.

5. CONCLUSIONS

In conclusion, we performed the first investigation of the effects of maca extracts on glucose and lipid homeostasis in insulin‐resistant cells and the possible underlying mechanism involving the PI3K/AKT signalling pathway. The results showed that maca ethanol extracts exhibited significant antioxidant capacity. In addition, subfractions of maca ethanol extract could improve glucose and lipid metabolic disorders in HepG2 cells. In particular, the NBT phase of maca ethanol extract showed the most significant ability to improve glucose and lipid homeostasis. In addition, the active components in the NBT fraction were also identified. As an initial step to further investigate the mechanism, we partly revealed that the NBT phase of maca ethanol extract contained the active component benzyl glucosinolate and could improve glucose and lipid metabolism by upregulating PI3K and AKT.

CONFLICT OF INTEREST

The authors declare no conflicts of interest.

ETHICAL APPROVAL

This study does not involve any human or animal testing.

Supporting information

Supplementary Material

Click here for additional data file. (279.5KB, doc)

ACKNOWLEDGMENTS

The authors thank the Key Laboratory of Carbohydrate Chemistry and Biotechnology (Jiangnan University), Ministry of Education for the technical support provided.

Li A, Liu J, Ding F, et al. Maca extracts regulate glucose and lipid metabolism in insulin‐resistant HepG2 cells via the PI3K/AKT signalling pathway. Food Sci Nutr. 2021;9:2894–2907. 10.1002/fsn3.2246

ENDNOTE

1

Rosemary (Rosmarinus officinalis L.) Extract Regulates Glucose and Lipid Metabolism by Activating AMPK and PPAR Pathways in HepG2 Cells.

REFERENCES

  1. Abdul‐Ghani, M. A. , & Defronzo, R. A. (2010). Pathogenesis of insulin resistance in skeletal muscle. Journal of Biomedicine Biotechnology, 2010(1), 476279. 10.1155/2010/476279 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bagherniya, M. , Nobili, V. , Blesso, C. N. , & Sahebkar, A. (2018). Medicinal plants and bioactive natural compounds in the treatment of non‐alcoholic fatty liver disease: A clinical review. Pharmacological Research, 130, 213–240. 10.1016/j.phrs.2017.12.020 [DOI] [PubMed] [Google Scholar]
  3. Beltowski, J. , Wojcicka, G. , & Jamroz‐Wisniewska, A. (2009). Adverse effects of statins—Mechanisms and consequences. Current Drug Safety, 4(3), 209–228. [DOI] [PubMed] [Google Scholar]
  4. Benzie, I. F. F. , & Szeto, Y. T. (1999). Total antioxidant capacity of teas by the ferric reducing/antioxidant power assay. Journal of Agricultural and Food Chemistry, 47(2), 633–636. 10.1021/jf9807768 [DOI] [PubMed] [Google Scholar]
  5. Castillo, J. J. , Mull, N. , Reagan, J. L. , Nemr, S. , & Mitri, J. (2012). Increased incidence of non‐Hodgkin lymphoma, leukemia, and myeloma in patients with diabetes mellitus type 2: A meta‐analysis of observational studies. Blood, 119(21), 4845–4850. 10.1182/blood-2011-06-362830 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Chen, B. , & Wu, Q. (2005). The relationship between free fatty acid, insulin resistance and pancreas B cell dysfunction. Chinese Journal of Integrative Medicine on Cardio‐/Cerebrovascular Disease, 2005(12), 1089–1092. [Google Scholar]
  7. Choi, E. H. , Kang, J. I. , Cho, J. Y. , Lee, S. H. , Kim, T. S. , Yeo, I. H. , & Chun, H. S. (2012). Supplementation of standardized lipid‐soluble extract from maca (Lepidium meyenii) increases swimming endurance capacity in rats. Journal of Functional Foods, 4(2), 568–573. 10.1016/j.jff.2012.03.002 [DOI] [Google Scholar]
  8. Duarte, C. K. , Santos, A. L. T. D. , Kirst, C. , Nunes, G. S. , de Franceschi, K. , de Azevedo, M. J. , & Zelmanovitz, T. (2019). Dietary source of saturated fat and percentage body fat of patients with type 2 diabetes mellitus: A cross‐sectional study. Food Science & Nutrition, 7(1), 195–204. 10.1002/fsn3.853 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Eid, H. M. , Thong, F. , Nachar, A. , & Haddad, P. S. (2017). Caffeic acid methyl and ethyl esters exert potential antidiabetic effects on glucose and lipid metabolism in cultured murine insulin‐sensitive cells through mechanisms implicating activation of AMPK. Pharmaceutical Biology, 55(1), 2026–2034. 10.1080/13880209.2017.1345952 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Feng, Y. X. L. , Sun, L. , Shi, L. , Chen, X. M. , & Zhang, Z. H. (2010). In vitro antioxidant activity of ethanol extract of Maca (Lepidium meyenii Walpers) cultivated in Yunnan. Food Science, 15, 46–50. [Google Scholar]
  11. Gonzales, G. F. (2015). Extracts of black Maca reduces Glycemia on Streptozotocin‐induced diabetes in male rats and reduces insulin resistance (IR) in HepG2 cell line in vitro. Endocrine Society. [Google Scholar]
  12. Guzman‐Perez, V. (2014). Effect of benzylglucosinolate on signaling pathways associated with type 2 diabetes prevention. Universität Potsdam. [Google Scholar]
  13. Hao, L. , Tian, A. , Zhang, L. , Liu, N. , Wang, X. , Yu, J. , Chen, Q. , & Yang, Y. (2014). Optimization of polyphenols extraction from Maca (Lepidium Meyenii) leaves by response surface methodology. Journal of Chinese Institute of Food Science, 14(12), 86–93. [Google Scholar]
  14. Hardie, D. G. (2004). The AMP‐activated protein kinase pathway: New players upstream and downstream. Journal of Cell Science, 117(23), 5479–5487. 10.1242/jcs.01540 [DOI] [PubMed] [Google Scholar]
  15. Howard, B. V. (1999). Insulin resistance and lipid metabolism. The American Journal of Cardiology, 84(1‐supp‐S1), 28–32. 10.1016/S0002-9149(99)00355-0 [DOI] [PubMed] [Google Scholar]
  16. Hwang, S. L. , Kim, H. N. , Jung, H. H. , Kim, J.‐E. , Choi, D.‐K. , Hur, J.‐M. , Lee, J.‐Y. , Song, H. , Song, K.‐S. , & Huh, T.‐L. (2008). Beneficial effects of β‐sitosterol on glucose and lipid metabolism in L6 myotube cells are mediated by AMP‐activated protein kinase. Biochemical and Biophysical Research Communications, 377(4), 1253–1258. 10.1016/j.bbrc.2008.10.136 [DOI] [PubMed] [Google Scholar]
  17. Atlas, D , & International Diabetes Federation . (2019). IDF Diabetes Atlas, 9th ed. Brussels. [Google Scholar]
  18. Lee, H. J. , Shin, C. , Chun, Y. S. , Kim, J. , Jung, H. , Choung, J. , & Shim, S. M. (2020). Physicochemical properties and bioavailability of naturally formulated fat‐soluble vitamins extracted from agricultural products for complementary use for natural vitamin supplements. Food Science & Nutrition, 8(10), 5660–5672. 10.1002/fsn3.1804 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Lenhard, J. M. , Kliewer, S. A. , Paulik, M. A. , Plunket, K. D. , Lehmann, J. M. , & Weiel, J. E. (1997). Effects of troglitazone and metformin on glucose and lipid metabolism: Alterations of two distinct molecular pathways. Biochemical Pharmacology, 54(7), 801–808. [DOI] [PubMed] [Google Scholar]
  20. Li, J. , Feng, J. , Wei, H. , Liu, Q. , Yang, T. , Hou, S. , Zhao, Y. , Zhang, B. , & Yang, C. (2018). The aqueous extract of Gynura divaricata (L.) DC. Improves glucose and lipid metabolism and ameliorates Type 2 diabetes mellitus. Evidence‐Based Complementary Alternative Medicine, 2018(5), 1–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Liu, J. , Zhang, H. , Ji, B. , Cai, S. B. , Wang, R. J. , Zhou, F. , Yang, J. S. , & Liu, H. J. (2014). A diet formula of Puerariae radix, Lycium barbarum, Crataegus pinnatifida, and Polygonati rhizoma alleviates insulin resistance and hepatic steatosis in CD‐1 mice and HepG2 cells. Food Function, 5(5), 1038. 10.1039/C3FO60524H [DOI] [PubMed] [Google Scholar]
  22. Liu, T. , Wang, P. , Cong, M. , Zhao, X. , Zhang, D. , Xu, H. , Liu, L. , Jia, J. , & You, H. (2018). Diethyldithiocarbamate, an anti‐abuse drug, alleviates steatohepatitis and fibrosis in rodents through modulating lipid metabolism and oxidative stress. British Journal of Pharmacology, 175(24), 4480–4495. 10.1111/bph.14503 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Long‐Bo, Z. , Qing‐Xiu, H. , Li, Z. , Jian, Y. , Min, C. , Li‐Ping, K. , & Lu‐Qi, H. (2017). Quality evaluation method of Lepidium meyenii using UPLC‐UV‐Q‐TOF‐MS. China Journal of Chinese Materia Medica, 5, 4957–4963. [DOI] [PubMed] [Google Scholar]
  24. Marinković, M. D. , Belić, B. , Cincović, M. R. , Đoković, R. , Lakić, I. , Stojanac, N. , Stevančević, O. , & Devečerski, G. (2019). Relationship between insulin, glucose, non‐esterified fatty acid and indices of insulin resistance in obese cows during the dry period and early lactation. Acta Veterinaria Brno, 88(2), 143–155. 10.2754/avb201988020143 [DOI] [Google Scholar]
  25. Mensor, L. L. , Menezes, F. S. , Leitão, G. G. , Reis, A. S. , Santos, T. C. , Coube, C. S. , & Leitão, S. G. (2001). Screening of Brazilian plant extracts for antioxidant activity by the use of DPPH free radical method. Phytotherapy Research, 15(2), 127–130. 10.1002/ptr.687 [DOI] [PubMed] [Google Scholar]
  26. Miao, H. Y. , Guo, R. F. , Zhao, Y. T. , & Wang, Q. M. (2012). Current progress in the regulation of glucosinolate metabolism and glucose signaling. Journal of Food Safety and Quality Inspection, 3(5), 367–372. [Google Scholar]
  27. Park, S. , Lim, S. , Chang, W. , Song, H. , Lee, S. , Song, B.‐W. , Kim, H.‐J. , Cha, M.‐J. , Choi, E. , Jang, Y. , Chung, N. , Cho, S. Y. , & Hwang, K.‐C. (2008). The inhibition of insulin‐stimulated proliferation of vascular smooth muscle cells by rosiglitazone is mediated by the Akt‐mTOR‐P70S6K pathway. Yonsei Medical Journal, 49(4), 592–600. 10.3349/ymj.2008.49.4.592 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Peppa, M. , Koliaki, C. , Nikolopoulos, P. , & Raptis, S. A. (2015). Skeletal muscle insulin resistance in endocrine disease. Journal of Biomedicine & Biotechnology, 2010(1110–7243), 527850. 10.1155/2010/527850 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Perrone, A. , Plaza, A. , Pizza, C. et al (2007) Lepidium meyenii (maca): Chemistry and biological activity.
  30. Saltiel, A. R. , & Kahn, C. R. (2001). Insulin signalling and the regulation of glucose and lipid metabolism. Nature, 414(6865), 799–806. 10.1038/414799a [DOI] [PubMed] [Google Scholar]
  31. Schram, M. T. , Sep, S. J. S. , van der Kallen, C. J. , Dagnelie, P. C. , Koster, A. , Schaper, N. , Henry, R. M. A. , & Stehouwer, C. D. A. (2014). The Maastricht Study: An extensive phenotyping study on determinants of type 2 diabetes, its complications and its comorbidities. European Journal of Epidemiology, 29(6), 439–451. 10.1007/s10654-014-9889-0 [DOI] [PubMed] [Google Scholar]
  32. Schultze, S. M. , Hemmings, B. A. , Niessen, M. , & Tschopp, O. (2012). PI3K/AKT, MAPK and AMPK signalling: Protein kinases in glucose homeostasis. Expert Reviews in Molecular Medicine, 14, 1462–3994. 10.1017/S1462399411002109 [DOI] [PubMed] [Google Scholar]
  33. Shen, Y. , Yang, S. , Hu, X. , Zhang, M. , Ma, X. , Wang, Z. , Hou, Y. , & Bai, G. (2019). Natural product puerarin activates Akt and ameliorates glucose and lipid metabolism dysfunction in hepatic cells. Journal of Functional Foods, 55, 296–304. 10.1016/j.jff.2019.02.035 [DOI] [Google Scholar]
  34. Shi, Y. , & Hu, F. B. (2014). The global implications of diabetes and cancer. The Lancet, 383(9933), 1947–1948. 10.1016/S0140-6736(14)60886-2 [DOI] [PubMed] [Google Scholar]
  35. So, W. Y. , & Leung, P. S. (2016). Irisin ameliorates hepatic glucose/lipid metabolism and enhances cell survival in insulin‐resistant human HepG2 cells through adenosine monophosphate‐activated protein kinase signaling. International Journal of Biochemistry Cell Biology, 78, 237–247. 10.1016/j.biocel.2016.07.022 [DOI] [PubMed] [Google Scholar]
  36. Steinberg, G. R. , & Kemp, B. E. (2009). AMPK in health and disease. Physiological Reviews, 89(3), 1025–1078. 10.1152/physrev.00011.2008 [DOI] [PubMed] [Google Scholar]
  37. Uchiyama, F. , Jikyo, T. , Takeda, R. , & Ogata, M. (2014). Lepidium meyenii (Maca) enhances the serum levels of luteinising hormone in female rats. Journal of Ethnopharmacology, 151(2), 897–902. 10.1016/j.jep.2013.11.058 [DOI] [PubMed] [Google Scholar]
  38. Vecera, R. , Orolin, J. , Kottová, N. , Kazdová, L. , Oliyarnik, O. , Ulrichová, J. , & Šimánek, V. (2007). The influence of Maca (Lepidium meyenii) on antioxidant status, lipid and glucose metabolism in rat. Plant Foods for Human Nutrition, 62(2), 59–63. 10.1007/s11130-007-0042-z [DOI] [PubMed] [Google Scholar]
  39. Wang, D. (2015). Study on the active components in Yunnan Maca and its extracts by UPLC‐MS. Strait Pharmaceutical Journal, 27(4), 79–80. [Google Scholar]
  40. Wenting, W. , Hongxiang, L. , Jiamei, X. , Yi, F. , Xu, L. , Jiang, B. , & Xiao, P. (2018). Aqueous extract of black Maca prevents metabolism disorder via regulating the glycolysis/gluconeogenesis‐TCA cycle and PPARα signaling activation in golden hamsters fed a high‐fat. High‐Fructose Diet. Frontiers in Pharmacology, 9, 333. 10.3389/fphar.2018.00333 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Xing Li, S. Y. , & Chen, R. (2017). Progress in the study of active constituent in Maca by Mass Spectrometry. Advances in Analytical Chemistry, 7(3), 185–195. [Google Scholar]
  42. Yoon, S. A. , Kang, S.‐I. , Shin, H.‐S. , Kang, S.‐W. , Kim, J.‐H. , Ko, H.‐C. , & Kim, S.‐J. (2013). p‐Coumaric acid modulates glucose and lipid metabolism via AMP‐activated protein kinase in L6 skeletal muscle cells. Biochemical Biophysical Research Communications, 432(4), 553–557. 10.1016/j.bbrc.2013.02.067 [DOI] [PubMed] [Google Scholar]
  43. Yue, Z. , Zhang, W.‐C. , Wu, Z.‐Y. , Fu, C.‐X. , Hui, A.‐L. , Gao, H. , Chen, P.‐P. , Du, B. , & Zhang, H.‐W. (2019). Two macamide extracts relieve physical fatigue by attenuating muscle damage in mice. Journal of the Science of Food and Agriculture, 99, 1405–1412. 10.1002/jsfa.9318 [DOI] [PubMed] [Google Scholar]
  44. Zevallos‐Concha, A. , Nuñez, D. , Gasco, M. , Vasquez, C. , Quispe, M. , & Gonzales, G. F. (2016). Effect of gamma irradiation on phenol content, antioxidant activity and biological activity of black maca and red maca extracts (Lepidium meyenii walp). Toxicology Mechanisms and Methods, 26(1), 67–73. [DOI] [PubMed] [Google Scholar]
  45. Zhang, L. (2017). Hypoglycemic effect and mechanism of Maca on type 2 diabetes mellitus. University of Chinese Academy of Sciences. [Google Scholar]
  46. Zhang, Y. , Chen, S. , Wei, C. , Chen, J. , & Ye, X. (2017). Proanthocyanidins from Chinese bayberry (Myrica rubra Sieb. et Zucc.) leaves regulate lipid metabolism and glucose consumption by activating AMPK pathway in HepG2 cells. Journal of Functional Foods, 29, 217–225. 10.1016/j.jff.2016.12.030 [DOI] [Google Scholar]
  47. Zhang, Y. , Liu, X. , Han, L. , Gao, X. , Liu, E. , & Wang, T. (2013). Regulation of lipid and glucose homeostasis by mango tree leaf extract is mediated by AMPK and PI3K/AKT signaling pathways. Food Chemistry, 141(3), 2896–2905. 10.1016/j.foodchem.2013.05.121 [DOI] [PubMed] [Google Scholar]
  48. Zhao, L. , Guo, X. , Wang, O. , Zhang, H. , Wang, Y. , Zhou, F. , Liu, J. , & Ji, B. (2016). Fructose and glucose combined with free fatty acids induce metabolic disorders in HepG2 cell: A new model to study the impacts of high‐fructose/sucrose and high‐fat diets in vitro. Molecular Nutrition Food Research, 60(4), 909–921. 10.1002/mnfr.201500635 [DOI] [PubMed] [Google Scholar]
  49. Zhou, Y. , Li, P. , Brantner, A. , Wang, H. , Shu, X. , Yang, J. , Si, N. , Han, L. , Zhao, H. , & Bian, B. (2017). Chemical profiling analysis of Maca using UHPLC‐ESI‐Orbitrap MS coupled with UHPLC‐ESI‐QqQ MS and the neuroprotective study on its active ingredients. Scientific Reports, 7, 44660. 10.1038/srep44660 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material

Click here for additional data file. (279.5KB, doc)

Articles from Food Science & Nutrition are provided here courtesy of Wiley

RESOURCES