Key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Drosophila melanogaster) | loaf | Flybase | FLYB: FBgn0036202 | CG6024 |
| Genetic reagent (D. melanogaster) | Rh5-GFP | Bloomington Drosophila Stock Center | BDSC:8600 FLYB: FBti0038634 |
FlyBase Symbol: P{Rh5-EGFP.P} |
| Genetic reagent (D. melanogaster) | Rh6-GFP | Bloomington Drosophila Stock Center | BDSC:7461 FLYB: FBti0038637 |
FlyBase Symbol: P{Rh6-EGFP.P} |
| Genetic reagent (D. melanogaster) | gl-lacZ | Moses and Rubin, 1991 | FLYB: FBtp0001226 | FlyBase Symbol: Ecol\lacZ5xglBS.38-1 |
| Genetic reagent (D. melanogaster) | R22E09-LexA | Pecot et al., 2013 | FLYB: FBtp0108724 | FlyBase Symbol: P{R22E09-nlsLexA::GADfl} |
| Genetic reagent (D. melanogaster) | LexAop:myrTomato | Pecot et al., 2013 | FLYB: FBtp0141256 | FlyBase Symbol: M{13xlexAop-tdTomato.IVS.Myr} |
| Genetic reagent (D. melanogaster) | GMR-GAL4 | Pecot et al., 2013 | FLYB: FBtp0001315 | FlyBase Symbol: P{GAL4-ninaE.GMR} |
| Genetic reagent (D. melanogaster) | ey3.5-FLP | Bloomington Drosophila Stock Center | BDSC:35542 FLYB: FBti0141243 |
FlyBase Symbol: P{ey3.5-FLP.B} |
| Genetic reagent (D. melanogaster) | Act>CD2>GAL4 | Bloomington Drosophila Stock Center | BDSC:4780 FLYB: FBti0012408 |
FlyBase Symbol: P{GAL4-Act5C(FRT.CD2).P}S |
| Genetic reagent (D. melanogaster) | lGMR-GAL4 | Bloomington Drosophila Stock Center | BDSC: 8605 FLYB: FBti0058798 |
FlyBase Symbol: P{longGMR-GAL4} |
| Genetic reagent (D. melanogaster) | UAS-loaf RNAiBL | Bloomington Drosophila Stock Center | BDSC: 28625 FLYB: FBti0127178 |
FlyBase Symbol: RNAiBL P{TRiP.JF03040}attP2 |
| Genetic reagent (D. melanogaster) | UAS-loaf RNAiKK | Viennna Drosophila Resource Center | VDRC: 102704 FLYB: FBst0474570 |
FlyBase Symbol: P{KK112220}VIE-260B |
| Genetic reagent (D. melanogaster) | UAS-LarRNAi | Viennna Drosophila Resource Center | VDRC: 107996 FLYB: FBst0479809 |
FlyBase Symbol: P{KK100581}VIE-260B |
| Genetic reagent (D. melanogaster) | UAS-dcr2 | Bloomington Drosophila Stock Center | BDSC: 24650 FLYB: FBti0100275 |
FlyBase Symbol: P{UAS-Dcr-2.D} |
| Genetic reagent (D. melanogaster) | panR7-lacZ | Hofmeyer et al., 2006 | FLYB: FBtp0022109 | FlyBase Symbol: P{PanR7-lacZ} |
| Genetic reagent (D. melanogaster) | nos-Cas9 | Bloomington Drosophila Stock Center | BDSC: 54591 FLYB: FBti0159183 | FlyBase Symbol: M{nos-Cas9.P}ZH-2A |
| Genetic reagent (D. melanogaster) | UAS-Cas9-P2 | Bloomington Drosophila Stock Center | BDSC: 58986 FLYB: FBti0166500 |
FlyBase Symbol: P{UAS-Cas9.P2}attP2 |
| Genetic reagent (D. melanogaster) | DIP-γ-GAL4 | Carrillo et al., 2015 | FLYB: FBal0319064 | FlyBase Symbol: DIP-γMI03222-GAL4 |
| Genetic reagent (D. melanogaster) | tj-GAL4NP1624 | Kyoto Drosophila Stock Center | Kyoto: 104055 FLYB: FBst0302922 | FlyBase Symbol: P{GawB}NP1624/CyO |
| Genetic reagent (D. melanogaster) | drf-GAL4 | Brody et al., 2012 | FLYB: FBal0270054 | FlyBase Symbol: GAL4vvl.43 |
| Genetic reagent (D. melanogaster) | loafMiMIC-GFSTF | Bloomington Drosophila Stock Center | BDSC: 64464 FLYB: FBti0181845 | FlyBase Symbol: Mi{PT-GFSTF.1}CG6024MI00316-GFSTF.1 |
| Genetic reagent (D. melanogaster) | ap-GAL4 | Bloomington Drosophila Stock Center | BDSC: 3041 FLYB: FBti0002785 | FlyBase Symbol: P{GawB}apmd544 |
| Genetic reagent (D. melanogaster) | ChAT-GAL4 | Bloomington Drosophila Stock Center | BDSC: 6798 FLYB: FBti0024050 | FlyBase Symbol: P{ChAT-GAL4.7.4} |
| Genetic reagent (D. melanogaster) | repo-GAL4 | Bloomington Drosophila Stock Center | BDSC: 7415 FLYB: FBti0018692 | FlyBase Symbol: P{GAL4}repo |
| Genetic reagent (D. melanogaster) | hth-GAL4 | Wernet et al., 2003 | FLYB: FBti0058519 | FlyBase Symbol: P{GawB}hthGAL4 |
| Genetic reagent (D. melanogaster) | bsh-GAL4 | Hasegawa et al., 2011 | FLYB: FBtp0069756 | FlyBase Symbol: P{bsh-GAL4.H} |
| Genetic reagent (D. melanogaster) | Vsx-GAL4 | Bloomington Drosophila Stock Center | BDSC: 29031 FLYB: FBti0037957 | FlyBase Symbol: P{GawB}MzVum |
| Genetic reagent (D. melanogaster) | VGlut-GAL4 | Bloomington Drosophila Stock Center | BDSC: 26160 FLYB: FBti0076967 | FlyBase Symbol: P{GawB}VGlutOK371 |
| Genetic reagent (D. melanogaster) | GMR9D03-GAL4 | Bloomington Drosophila Stock Center | BDSC: 40726 FLYB: FBti0152068 | FlyBase Symbol: P{GMR9D03-GAL4}attP2 |
| Genetic reagent (D. melanogaster) | GH146-GAL4 | Bloomington Drosophila Stock Center | BDSC: 30026 FLYB: FBti0016783 | FlyBase Symbol: P{GawB}GH146 |
| Genetic reagent (D. melanogaster) | dveNP3428-GAL4 | Kyoto Drosophila Stock Center | Kyoto: 113273 FLYB: FBti0035416 | FlyBase Symbol: P{GawB}dveNP3428 |
| Genetic reagent (D. melanogaster) | vg-GAL4 | Bloomington Drosophila Stock Center | BDSC: 6819 FLYB: FBal0047077 | FlyBase Symbol: GAL4vg.PM |
| Genetic reagent (D. melanogaster) | ortC1a-GAL4 | Bloomington Drosophila Stock Center | BDSC: 56519 FLYB: FBti0161257 | FlyBase Symbol: P{ort-GAL4.C1a} |
| Genetic reagent (D. melanogaster) | ortC2b-GAL4 | Ting et al., 2014 | FLYB: FBtp0093983 | FlyBase Symbol: P{ort-GAL4.C2b} |
| Genetic reagent (D. melanogaster) | GMR64H01-GAL4 | Bloomington Drosophila Stock Center | BDSC: 39322 FLYB: FBti0137495 | FlyBase Symbol: P{GMR64H01-GAL4}attP2 |
| Genetic reagent (D. melanogaster) | UAS-LarHA | Hofmeyer and Treisman, 2009 | FLYB: FBal0193546 | FlyBase Symbol: LarUAS.Tag:HA |
| Genetic reagent (D. melanogaster) | UAS-Lrp4HA | Mosca et al., 2017 | FLYB: FBal0326704 | FlyBase Symbol: Lrp4UAS.Tag:HA,Tag:FLAG |
| Genetic reagent (D. melanogaster) | Lrp4dalek | Mosca et al., 2017 | FLYB: FBal0326703 | FlyBase Symbol: Lrp4dalek |
| Genetic reagent (D. melanogaster) | Liprin-αoos | Hofmeyer et al., 2006 | FLYB: FBal0193553 | FlyBase Symbol: Liprin-αoos |
| Genetic reagent (D. melanogaster) | GMR9D03-DBD | Bloomington Drosophila Stock Center | BDSC: 68766 FLYB: FBti0192157 | FlyBase Symbol: P{R9D03-GAL4.DBD}attP2 |
| Genetic reagent (D. melanogaster) | GMR38H04-AD | Bloomington Drosophila Stock Center | BDSC: 75758 FLYB: FBti0188278 | FlyBase Symbol: P{R38H04-p65.AD}attP40 |
| Genetic reagent (D. melanogaster) | MCFO-1 | Nern et al., 2015 | FLYB: FBti0169283 | FlyBase Symbol: PBac{10XUAS(FRT.stop)myr::smGdP-HA}VK00005-P{10xUAS(FRT.stop)myr::smGdP-V5-THS-10xUAS(FRT.stop)myr::smGdP-FLAG}su(Hw) |
| Genetic reagent (D. melanogaster) | TSG1012 | Moberg et al., 2005 | FLYB: FBal0212938 | FlyBase Symbol: TSG1012 |
| Genetic reagent (D. melanogaster) | loafΔ33 | This paper | CRISPR deletion allele; see Materials and methods | |
| Genetic reagent (D. melanogaster) | loafΔ20 | This paper | CRISPR deletion allele; see Materials and methods | |
| Genetic reagent (D. melanogaster) | UAS-LoafHA | This paper | Inserted at VK1 attP site | |
| Genetic reagent (D. melanogaster) | UAS-Loaf | This paper | Inserted at VK1 attP site | |
| Genetic reagent (D. melanogaster) | pCFD4-loaf sgRNAs | This paper | Inserted at attP40 site | |
| Cell line (D. melanogaster) | S2 | Laboratory of Ruth Lehmann | FLYB:FBtc0000181; RRID:CVCL_Z992 | FlyBase symbol: S2-DRSC. |
| Antibody | Anti-Chp (Mouse monoclonal) | Developmental Studies Hybridoma Bank | Cat# 24B10, RRID:AB_528161 | IF(1:50) |
| Antibody | Anti-GFP (Chicken polyclonal) | Life Technologies | Cat# A10262, RRID:AB_2534023 | IF(1:400) |
| Antibody | Anti-HA (Rat monoclonal) | Sigma (Roche 3F10) | Cat# 11 867 423 001, RRID:AB_390918 | IF(1:400) |
| Antibody | Anti-β-galactosidase (Rabbit polyclonal) | Fisher | Cat# A11132, RRID:AB_221539 | IF(1:100) |
| Antibody | Anti-Ncad (Rat monoclonal) | Developmental Studies Hybridoma Bank | Cat# DN-Ex #8, RRID:AB_528121 | IF(1:50) |
| Antibody | Anti-DsRed (Rabbit polyclonal) | Takara Bio | Cat# 632496, RRID:AB_10013483 | IF(1:50) |
| Antibody | Anti-Loaf (Guinea pig polyclonal) | Proteintech (this paper) | IF(1:400) WB(1:1000) See Materials and methods |
|
| Antibody | Anti-Cnx99A (Mouse monoclonal) | Developmental Studies Hybridoma Bank | Cat# Cnx99A 6-2-1, RRID:AB_2722011 | IF(1:10) |
| Antibody | Anti-Hrs (Mouse monoclonal) | Developmental Studies Hybridoma Bank | Cat# Hrs 27–4, RRID:AB_2618261 | IF(1:10) |
| Antibody | Anti-Rab7 (Mouse monoclonal) | Developmental Studies Hybridoma Bank | Cat# Rab7, RRID:AB_2722471 | IF(1:10) |
| Antibody | Anti-ATP6V1B1 (Rabbit polyclonal) | Abgent | Cat# AP11538C, RRID:AB_10816749 | IF(1:200) |
| Antibody | Anti-Arl8 (Rabbit polyclonal) | Developmental Studies Hybridoma Bank | Cat# Arl8, RRID:AB_2618258 | IF(1:200) |
| Antibody | Anti-Elav (Rat monoclonal) | Developmental Studies Hybridoma Bank | Cat# Rat-Elav-7E8A10 anti-elav, RRID:AB_528218 | IF(1:100) |
| Antibody | Anti-Notch (Mouse monoclonal) | Developmental Studies Hybridoma Bank | Cat# C17.9C6, RRID:AB_528410 | IF(1:10) |
| Antibody | Anti-Arm (Mouse monoclonal) | Developmental Studies Hybridoma Bank | Cat# N2 7A1 Armadillo, RRID:AB_528089 | IF(1:10) |
| Antibody | Anti-GFP (Sheep polyclonal) | BioRad | Cat# 4745–1051, RRID:AB_619712 | IF(1:200) |
| Antibody | Anti-RFP (Rabbit polyclonal) | MBL International | Cat# PM005, RRID:AB_591279 | IF(1:500) |
| Antibody | Anti-V5 (Rabbit polyclonal) | Abcam | Cat# ab9116, RRID:AB_307024 | IF(1:1000) |
| Antibody | Anti-FLAG (Mouse monoclonal) | Sigma | Cat# F3165, RRID:AB_259529 | IF(1:500) |
| Antibody | Anti-Dac (Mouse monoclonal) | Developmental Studies Hybridoma Bank | Cat# mAbdac2-3, RRID:AB_528190 | IF(1:40) |
| Antibody | Anti-Bsh (Rabbit polyclonal) | Özel et al., 2021 | IF(1:1800) | |
| Antibody | Anti-Runt (Guinea pig polyclonal) | Genscript (this paper) | IF(1:600) See Materials and methods |
|
| Antibody | Anti-β-tubulin (Mouse monoclonal) | Sigma | Cat# T4026, RRID:AB_477577 | WB (1:10,000) |
| Recombinant DNA reagent | UAS-HASdk | Astigarraga et al., 2018 | In UASt-attB | |
| Recombinant DNA reagent | UAS-LoafHA | Drosophila Genomics Resource Center | Clone UFO07678 | In UASt-attB |
| Recombinant DNA reagent | UAS-Loaf | This paper | See Materials and methods | |
| Recombinant DNA reagent | UAS-V5Loaf | This paper | See Materials and methods | |
| Sequence-based reagent | Loaf_F | This paper | PCR primer | CGCACGAACTTTGTGACACT |
| Sequence-based reagent | Loaf_R | This paper | PCR primer | CTCAAGTCAATCGGTCCTTCC |
| Commercial assay or kit | SuperSignal WestPico | ThermoFisher | Cat # 34579 | |
| Software, algorithm | Fiji-ImageJ | NIH | https://fiji.sc/ |