| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Biological Samples | ||
| Ash002 | This study | 2 |
| Ash033 | This study | 33 |
| Ash040 | This study | 40 |
| Ash128 | This study | 128 |
| Ash129 | This study | 129 |
| Ash131 | This study | 131 |
| Ash133 | This study | 133 |
| Ash136 | This study | 136 |
| cth006 | This study | 30006 |
| cth728 | This study | 2728 |
| cth842 | This study | 2842 |
| cth747 | This study | 5747 |
| pch034 | This study | 21981 |
| CCH144 | This study | 5357 |
| CCH285 | This study | 21855 |
| CCH163 | This study | 2017 |
| CCH289 | This study | 1885 |
| CCH290 | This study | 2033 |
| CCH294 | This study | 2779 |
| CCH311 | This study | 8587 |
| cth739 | This study | 11739 |
| cth217 | This study | 20217 |
| Chemicals, Peptides, and Recombinant Proteins | ||
| RNase Away | N/A | |
| Sodium Hypochloride | Sigma Aldrich | Cat#S7653 |
| HPLC water | Sigma Aldrich | Cat#270733 |
| Ispropanol | Merck | Cat#1009952500 |
| Proteinase K | Thermo Fisher Scientific | Cat#E00491 |
| Guanidine Hydrochloride | Sigma Aldrich | Cat#50950 |
| Tween-20 | BioShop | Cat#TWN508 |
| Ethanol | Isolab | Cat#920.026.2500 |
| EDTA disodium salt dihydrate | Sigma Aldrich | Cat#E5134 |
| Critical Commercial Assays | ||
| High Sensitivity DNA Kit (Bioanalyser 2100) | Agilent Technologies | Cat#5067-4626 |
| MYbaits Human Whole Genome Capture Kit (African baits) | Arbor Biosciences (Ann Arbor, MI) | Cat# 302508.v5 |
| High Sensitivity D1000 Screen Tape (Tapestation 2200) | Agilent Technologies | Cat# 5067-5584 |
| MinElute PCR Purification Kit | QIAGEN | Cat#28004 |
| Deposited Data | ||
| Ash002 BAM file | European Nucleotide Archive (ENA) | ENA: ERS4811035 |
| Ash033 BAM file | European Nucleotide Archive (ENA) | ENA: ERS4811084 |
| Ash040 BAM file | European Nucleotide Archive (ENA) | ENA: ERS4811085 |
| Ash128 BAM file | European Nucleotide Archive (ENA) | ENA: ERS4811086 |
| Ash129 BAM file | European Nucleotide Archive (ENA) | ENA: ERS4811087 |
| Ash131 BAM file | European Nucleotide Archive (ENA) | ENA: ERS4811088 |
| Ash133 BAM file | European Nucleotide Archive (ENA) | ENA: ERS4811089 |
| Ash136 BAM file | European Nucleotide Archive (ENA) | ENA: ERS4811090 |
| cth006 BAM file | European Nucleotide Archive (ENA) | ENA: ERS4811091 |
| cth728 BAM file | European Nucleotide Archive (ENA) | ENA: ERS4811092 |
| cth842 BAM file | European Nucleotide Archive (ENA) | ENA: ERS4811093 |
| cth747 BAM file | European Nucleotide Archive (ENA) | ENA: ERS4811094 |
| pch034 BAM file | European Nucleotide Archive (ENA) | ENA: ERS4811095 |
| CCH144 BAM file | European Nucleotide Archive (ENA) | ENA: ERS4811096 |
| CCH285 BAM file | European Nucleotide Archive (ENA) | ENA: ERS4811098 |
| CCH163 BAM file | European Nucleotide Archive (ENA) | ENA: ERS4811097 |
| CCH289 BAM file | European Nucleotide Archive (ENA) | ENA: ERS4811099 |
| CCH290 BAM file | European Nucleotide Archive (ENA) | ENA: ERS4811100 |
| CCH294 BAM file | European Nucleotide Archive (ENA) | ENA: ERS4811101 |
| CCH311 BAM file | European Nucleotide Archive (ENA) | ENA: ERS4811102 |
| cth739 BAM file | European Nucleotide Archive (ENA) | ENA: ERS4811103 |
| cth217 BAM file | European Nucleotide Archive (ENA) | ENA: ERS4811104 |
| Oligonucleotides | ||
| IS1_adapter.P5: 50-A∗C∗A∗C∗TCTTTCC CTACACGACGCTCTTCCG∗A∗T∗C∗T-30 (∗ indicates a PTO bond) |
49 | Biomers |
| IS2_adapter.P7: 50-G∗T∗G∗A∗CTGGAG TTCAGACGTGTGCTCTTCCG∗A∗T∗C∗T-30 (∗ indicates a PTO bond) |
49 | Biomers |
| IS3_adapter.P5+P7: 50-A∗G∗A∗T∗CGGAA∗ G∗A∗G∗C-30 (∗ indicates a PTO bond) |
49 | Biomers |
| IS4: (5¢-AATGATACGGCGACCACCGAG ATCTACACTCTTTCCCTACACGACGCT CTT 3¢) |
49 | Biomers |
| IS5: (5¢AATGATACGGCGACCACCGA) | 49 | Biomers |
| IS6: (5¢ AAGCAGAAGACGGCATACGA) | 49 | Biomers |
| P5 indexing: (5¢-AATGATACGGCGACC ACCGAGATCTACACxxxxxxxACACTCT TTCCCTACACGACGCTCTT 3¢) where x is one of 7 different 7 bp indexes |
49 | Biomers |
| P7 indexing: (5’-CAAGCAGAAGACGGC ATACGAGATxxxxxxxGTGACTGGAGT TCAGACGTGT 3’) where x is one of 22 different 7 bp indexes |
49 | Biomers |
| Software and Algorithms | ||
| MergeReadsFastQ_cc.py | 50 | https://bioinf.eva.mpg.de/fastqProcessing/ |
| AdapterRemoval | 51 | https://github.com/MikkelSchubert/adapterremoval |
| Burrows-Wheeler Aligner BWA aln 0.7.15 | 52, 53, 54 | http://bio-bwa.sourceforge.net/ |
| FilterUniqueSAMCons.py | 50 | https://bioinf.eva.mpg.de/fastqProcessing/ |
| PMDtools | 55 | https://github.com/pontussk/PMDtools |
| Samtools-0.1.19 | 56 | https://github.com/samtools/samtools |
| ANGSD | 57 | http://popgen.dk/angsd/index.php/ANGSD |
| HaploGrep2v2.1.1 | 58 | https://haplogrep.i-med.ac.at/ |
| EIGENSOFT | 59 | https://github.com/DReichLab/EIG |
| ADMIXTOOLS | 20 | https://github.com/DReichLab/AdmixTools |
| ADMIXTURE | 19 | https://dalexander.github.io/admixture/download.html |
| PLINK | 60 | https://www.cog-genomics.org/plink2 |
| PONG | 61 | https://github.com/ramachandran-lab/pong |
| NgsRelate | 34 | https://github.com/ANGSD/NgsRelate |
| lcMLkin | 35 | https://github.com/COMBINE-lab/maximum-likelihood-relatedness-estimation |
| READ | 36 | https://bitbucket.org/tguenther/read/src/master/ |
| HIrisPlex | 62, 63, 64 | http://hirisplex.erasmusmc.nl/ |
| Other | ||
| Agencourt AMPure XP beads (60 mL) | Beckman Coulter | Cat#A63881 |
| T4 Polynucleotide Kinase (T4 PNK) | Thermo Fisher Scientific | Cat#EK0032 |
| T4 DNA Ligase | Thermo Fisher Scientific | Cat#EL0011, EL0014 |
| Adenine Triphosphate (ATP) | Thermo Fisher Scientific | Cat#R0441 |
| T4 DNA Polymerase | Thermo Fisher Scientific | Cat#EP0062 |
| dNTP Set | Thermo Fisher Scientific | Cat#R0182, R0181 |
| dNTP Mix | Thermo Fisher Scientific | Cat#R1121, R1122 |
| Bst polymerase, large fragment | New England Biolabs | Cat#M0275S |
| 10X ThermoPol reaction buffer | New England Biolabs | Cat#B9004S |
| Amplitaq Gold 360 DNA Polymerase (with AmpliTaq Gold Buffer) | Thermo Fisher Scientific | Cat#4398833 |
| KAPA HiFi HotStart Uracil+ Kit | Kapa Biosystems | Cat#KK2801 |
| Herculase II Fusion DNA Polymerase | Agilent Technologies | Cat#600675 |
| 10X Tango Buffer | Thermo Fisher Scientific | Cat#BY5 |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.