KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| α-tubulin | Santa Cruz | Cat# sc-5286 |
| RPA2 | Abcam | Cat# ab2175 |
| RPA2 pS4/S8 | Abcam | Cat# Ab87277 |
| RPA2 pS33 | Bethyl | Cat# A300-246A |
| FANCD2 | Novus | Cat# NB100-183 |
| MCM2 pS40 | Abcam | Cat# Ab133243 |
| MCM2 | Bethyl | Cat# A300-191A |
| CHK1 | Santa Cruz | Cat# sc-8408 |
| CHK1 pS345 | Cell Signaling | Cat# 13303 |
| PDS5B | Bethyl | Cat# A300-537A |
| PDS5A | Bethyl | Cat# A300-088A |
| MERIT40/NBA1 | Bethyl | Cat# A302-516A |
| BRCC36 | Abcam | Cat# Ab108295 |
| CDC7 | MBL | Cat# K0070-3 |
| 53BP1 | BD Biosciences | Cat# 612522 |
| BrdU (B44) | BD Biosciences | Cat# 347580 |
| BrdU/CldU (BUI/75) | Abcam | Cat# Ab6326 |
| Abraxas/CCDC98 | Abcam | Cat# Ab139191 |
| BRE/BRCC45 | Abcam | Cat# Ab95985 |
| MCM7 | Santa Cruz | Cat# G966 |
| RNA polymerase II C-terminal repeat domain (CTD) pS2 | Abcam | Cat# Ab5095 |
| SMC3 | Bethyl | Cat# A300-060 |
| Rad21 | Bethyl | Cat# A700-052 |
| BRCA1 | Santa Cruz | Cat# sc-6954 |
| Anti-FLAG (M2) antibody | Sigma | Cat# F1804 |
| Anti-FLAG (M2) antibody-coupled magnetic beads | Sigma | Cat# M8823 |
| Goat anti-mouse-Alexa 488 conjugate | Invitrogen | Cat# A11029 |
| Goat anti-mouse-Alexa 568 conjugate | Invitrogen | Cat# A11004 |
| Goat anti-rabbit-Alexa 488 conjugate | Invitrogen | Cat# A11008 |
| Goat anti-rabbit-Alexa 568 conjugate | Invitrogen | Cat# A11011 |
| Bacterial and Virus Strains | ||
| BL21 (DE3) competent E. coli | NEB | Cat# C2527 |
| DH10B competent E. coli | Invitrogen | Cat# 18297010 |
| AdCre | Vector Development Lab, Baylor College of Medicine | N/A |
| Chemicals, Peptides, and Recombinant Proteins | ||
| BrdU | Sigma | Cat# B5002 CAS: 59-14-3 |
| hydroxyurea | Sigma | Cat# H8627 CAS: 127-07-1 |
| PHA-767491 | Selleckchem | Cat# S2742 CAS: 942425-68-5 |
| 1-NM-PP1 | Kevan Shokat | N/A |
| VE-821 | Cayman Chemicals | Cat# 17587 CAS: 1232410-49-9 |
| AZ20 | Sigma-Aldrich | Cat# SML-1328 CAS: 233339-22-4 |
| AZD-7762 | Sigma-Aldrich | Cat# SML-0350 CAS: 1246094-78-9 |
| roscovitine | Sigma-Aldrich | Cat# R7772 CAS: 186692-46-6 |
| RO-3306 | Millipore | Cat# 217699 CAS: 872573-93-8 |
| KU-60019 | Apex Bio Technology | Cat# 501014294 CAS: 925701-49-1 |
| caffeine | Sigma-Aldrich | Cat# C0750 CAS: 58-08-2 |
| Fugene 6 | Roche | E2691 |
| 3x FLAG Peptide | Sigma-Aldrich | Cat# F4799 |
| Cdc7-Dbf4 | Mark Frattini | N/A |
| S-protein agarose | Millipore | Cat# 69704 |
| Mitomycin C | Sigma-Aldrich | Cat# M4287 CAS: 50-07-7 |
| Critical Commercial Assays | ||
| Click-iT EdU Alexa Fluor 647 Imaging Kit | ThermoFisher | Cat# C10340 |
| Gibson Assembly master mix | NEB | Cat# E2611L |
| Gateway LR Clonase II enzyme mix | ThermoFisher | Cat# 11791020 |
| Gateway BP Clonase II enzyme mix | ThermoFisher | Cat# 11789100 |
| Pierce GST spin purification kit | ThermoFisher | Cat# 16106 |
| Deposited Data | ||
| Phosphoproteomics data | ProteomeXchange Consortium | dataset PXD014399 |
| Replication timing data | Sequence Read Archive | BioProject PRJNA684004 |
| Experimental Models: Cell Lines | ||
| RPE1 (hTERT-immortalized human retinal pigmented epithelial cell line) | Clontech | now ATCC CRL-4000 |
| RPE1 Cdc7wt | This paper | N/A |
| RPE1 Cdc7as | This paper | N/A |
| RPE1 Cdc7wt and Cdc7as + FLAP-PCNA & mKO-Cdt1 (30-120) | This paper | N/A |
| RPE1 PDS5B−/− clone #19 | This paper | N/A |
| RPE1 PDS5B−/− clone #26 | This paper | N/A |
| RPE1 PDS5B−/− #19 + pJC1-mCherry-HA-PDS5BWT | This paper | N/A |
| RPE1 PDS5B−/− #19 + pJC1-mCherry-HA-PDS5B4A | This paper | N/A |
| RPE1 PDS5B−/− #19 + pJC1-mCherry-HA-PDS5BΔC | This paper | N/A |
| RPE1 MERIT40−/− clone #22 | This paper | N/A |
| RPE1 MERIT40−/− #22 + pQCXIN-HA-MERIT40WT | This paper | N/A |
| RPE1 MERIT40−/− #22 + pQCXIN-HA-MERIT404A | This paper | N/A |
| RPE1 MERIT40−/− #22+pQCXIN-HA-MERIT40ΔC | This paper | N/A |
| RPE1 PDS5A−/− clone #20 | This paper | N/A |
| HCT116 (human colorectal cancer cell line) | Bruce Clurman (Hughes et al., 2013) | N/A |
| HCT116 CDK2AF/AF | Bruce Clurman (Hughes et al., 2013) | N/A |
| HEK293 (human embryonic kidney cell line) | ATCC | CRL-1573 |
| Phoenix-ECO (HEK293-derived retroviral packaging line) | ATCC | CRL-3214 |
| HeLa (human cervical cancer cell line) | ATCC | CCL-2 |
| HeLa + pQCXIN-FLAP-PDS5BWT | This paper | N/A |
| HeLa + pQCXIN-FLAP-PDS5B4A | This paper | N/A |
| HeLa + pQCXIN-FLAG-MERIT40WT | This paper | N/A |
| HeLa + pQCXIN-FLAG-MERIT404A | This paper | N/A |
| Experimental Models: Organisms/Strains | ||
| Xenopus laevis | N/A | RRID:NXR 0.031 |
| Recombinant DNA | ||
| pAAV-lacZ | Agilent | Cat# 240071 |
| pRC | Agilent | Cat# 240071 |
| pHelper | Agilent | Cat# 240071 |
| pAAV-CDC7flox | This paper | N/A |
| pAAV-CDC7Δ | This paper | N/A |
| pVSV-G | Takara | Cat# PT3343-5 |
| pcDNA5-FRT-TO-FLAP-DEST | Jallepalli Lab (Maciejowski et al., 2017) | N/A |
| pQCXIN | Takara | Cat# 631514 |
| pQC7N | This paper | N/A |
| pQC7N-FLAP-Cdc7wt | This paper | N/A |
| pQC7N-FLAP-Cdc7as | This paper | N/A |
| MaRX-hygro-mKO2-Cdt1 (30-120) | Gregory David (Bainor et al., 2018) | N/A |
| pQCXIN | Takara | N/A |
| hCas9 expression vector | George Church | Addgene 41815 |
| Empty gRNA vector | George Church | Addgene 41824 |
| MERIT40 gRNA vector; target CCACCACCAGTGCAAACTCG | This paper | N/A |
| PDS5A gRNA vector; target GTGAGATCCTTCGCTAAATC | This paper | N/A |
| PDS5B gRNA vector; target GCTGCCTTGCTGATATTTTC | This paper | N/A |
| pQCXIN-HA-MERIT40WT | This paper | N/A |
| pQCXIN-HA-MERIT404A (S7A S8A T10A S20A) | This paper | N/A |
| pQCXIN-HA-MERIT40 ΔC (Δ1-20) | This paper | N/A |
| pQCXIN-FLAP-PDS5BWT | This paper | N/A |
| pQCXIN-FLAP-PDS5B4A | This paper | N/A |
| pJC1 (“floxed” bicistronic retroviral vector with mCherry, HA epitope tag, and blasticidin resistance) | This paper | N/A |
| pJC1-mCherry-HA-PDS5BWT | This paper | N/A |
| pJC1-mCherry-HA-PDS5B4A (S1407A S1408A S1417A S1418A) | This paper | N/A |
| pJC1-mCherry-HA-PDS5B ΔC (Δ1394-1447) | This paper | N/A |
| pDONR221 | ThermoFisher | 12536017 |
| pDEST15-MERIT40WT (1-60) | This paper | N/A |
| pDEST15-MERIT404A (1-60 S7A S8A T10A S20A) | This paper | N/A |
| pDEST15-PDS5BWT (1391-1447) | This paper | N/A |
| pDEST15-PDS5B4A (1391-1447 S1407A S1408A S1417A S1418A) | This paper | N/A |
| pDEST15-CTF4WT (351-410) | This paper | N/A |
| pDEST15-CTF43A (351-410 S393A S394A S407A) | This paper | N/A |
| pDEST15-SETWT (1-49) | This paper | N/A |
| pDEST15-SET3A (1-49 S15A T23A S24A) | This paper | N/A |
| pDEST15-UBR5WT (1971-2000) | This paper | N/A |
| pDEST15-UBR52A (1971-2000 S1990A T1998A) | This paper | N/A |
| pDEST15-NEURL4WT (1071-1113) | This paper | N/A |
| pDEST15-NEURL45A (1071-1113 S1083A S1085A S1086A T1088A S1089A) | This paper | N/A |
| Software and Algorithms | ||
| BWA | (Li and Durbin, 2010) | https://github.com/lh3/bwa |
| Samtools | (Li et al., 2009) | http://www.htslib.org |
| MATLAB | MathWorks | N/A |
| MaxQuant (v1.0.14.7) | (Cox and Mann, 2008) | https://www.maxquant.org |
| MASCOT (v2.3.02) | Matrix Science | http://www.matrixscience.com/search_form_select.html |
| Perseus | (Tyanova et al., 2016) | https://maxquant.net/perseus/ |
| Fiji (v2.0) | ||
| NIS Elements-AR (v5.41) | Nikon Instruments | https://www.microscope.healthcare.nikon.com/products/software/nis-elements/nis-elements-advanced-research |
| Prism (v7) | GraphPad | https://www.graphpad.com |
| Lasergene (v.14) | DNASTAR | https://www.dnastar.com |