Skip to main content
. Author manuscript; available in PMC: 2022 Feb 4.
Published in final edited form as: Mol Cell. 2021 Feb 4;81(3):426–441.e8. doi: 10.1016/j.molcel.2021.01.004

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
α-tubulin Santa Cruz Cat# sc-5286
RPA2 Abcam Cat# ab2175
RPA2 pS4/S8 Abcam Cat# Ab87277
RPA2 pS33 Bethyl Cat# A300-246A
FANCD2 Novus Cat# NB100-183
MCM2 pS40 Abcam Cat# Ab133243
MCM2 Bethyl Cat# A300-191A
CHK1 Santa Cruz Cat# sc-8408
CHK1 pS345 Cell Signaling Cat# 13303
PDS5B Bethyl Cat# A300-537A
PDS5A Bethyl Cat# A300-088A
MERIT40/NBA1 Bethyl Cat# A302-516A
BRCC36 Abcam Cat# Ab108295
CDC7 MBL Cat# K0070-3
53BP1 BD Biosciences Cat# 612522
BrdU (B44) BD Biosciences Cat# 347580
BrdU/CldU (BUI/75) Abcam Cat# Ab6326
Abraxas/CCDC98 Abcam Cat# Ab139191
BRE/BRCC45 Abcam Cat# Ab95985
MCM7 Santa Cruz Cat# G966
RNA polymerase II C-terminal repeat domain (CTD) pS2 Abcam Cat# Ab5095
SMC3 Bethyl Cat# A300-060
Rad21 Bethyl Cat# A700-052
BRCA1 Santa Cruz Cat# sc-6954
Anti-FLAG (M2) antibody Sigma Cat# F1804
Anti-FLAG (M2) antibody-coupled magnetic beads Sigma Cat# M8823
Goat anti-mouse-Alexa 488 conjugate Invitrogen Cat# A11029
Goat anti-mouse-Alexa 568 conjugate Invitrogen Cat# A11004
Goat anti-rabbit-Alexa 488 conjugate Invitrogen Cat# A11008
Goat anti-rabbit-Alexa 568 conjugate Invitrogen Cat# A11011
Bacterial and Virus Strains
BL21 (DE3) competent E. coli NEB Cat# C2527
DH10B competent E. coli Invitrogen Cat# 18297010
AdCre Vector Development Lab, Baylor College of Medicine N/A
Chemicals, Peptides, and Recombinant Proteins
BrdU Sigma Cat# B5002
CAS: 59-14-3
hydroxyurea Sigma Cat# H8627
CAS: 127-07-1
PHA-767491 Selleckchem Cat# S2742
CAS: 942425-68-5
1-NM-PP1 Kevan Shokat N/A
VE-821 Cayman Chemicals Cat# 17587
CAS: 1232410-49-9
AZ20 Sigma-Aldrich Cat# SML-1328
CAS: 233339-22-4
AZD-7762 Sigma-Aldrich Cat# SML-0350
CAS: 1246094-78-9
roscovitine Sigma-Aldrich Cat# R7772
CAS: 186692-46-6
RO-3306 Millipore Cat# 217699
CAS: 872573-93-8
KU-60019 Apex Bio Technology Cat# 501014294
CAS: 925701-49-1
caffeine Sigma-Aldrich Cat# C0750
CAS: 58-08-2
Fugene 6 Roche E2691
3x FLAG Peptide Sigma-Aldrich Cat# F4799
Cdc7-Dbf4 Mark Frattini N/A
S-protein agarose Millipore Cat# 69704
Mitomycin C Sigma-Aldrich Cat# M4287
CAS: 50-07-7
Critical Commercial Assays
Click-iT EdU Alexa Fluor 647 Imaging Kit ThermoFisher Cat# C10340
Gibson Assembly master mix NEB Cat# E2611L
Gateway LR Clonase II enzyme mix ThermoFisher Cat# 11791020
Gateway BP Clonase II enzyme mix ThermoFisher Cat# 11789100
Pierce GST spin purification kit ThermoFisher Cat# 16106
Deposited Data
Phosphoproteomics data ProteomeXchange Consortium dataset PXD014399
Replication timing data Sequence Read Archive BioProject PRJNA684004
Experimental Models: Cell Lines
RPE1 (hTERT-immortalized human retinal pigmented epithelial cell line) Clontech now ATCC CRL-4000
RPE1 Cdc7wt This paper N/A
RPE1 Cdc7as This paper N/A
RPE1 Cdc7wt and Cdc7as + FLAP-PCNA & mKO-Cdt1 (30-120) This paper N/A
RPE1 PDS5B−/− clone #19 This paper N/A
RPE1 PDS5B−/− clone #26 This paper N/A
RPE1 PDS5B−/− #19 + pJC1-mCherry-HA-PDS5BWT This paper N/A
RPE1 PDS5B−/− #19 + pJC1-mCherry-HA-PDS5B4A This paper N/A
RPE1 PDS5B−/− #19 + pJC1-mCherry-HA-PDS5BΔC This paper N/A
RPE1 MERIT40−/− clone #22 This paper N/A
RPE1 MERIT40−/− #22 + pQCXIN-HA-MERIT40WT This paper N/A
RPE1 MERIT40−/− #22 + pQCXIN-HA-MERIT404A This paper N/A
RPE1 MERIT40−/− #22+pQCXIN-HA-MERIT40ΔC This paper N/A
RPE1 PDS5A−/− clone #20 This paper N/A
HCT116 (human colorectal cancer cell line) Bruce Clurman (Hughes et al., 2013) N/A
HCT116 CDK2AF/AF Bruce Clurman (Hughes et al., 2013) N/A
HEK293 (human embryonic kidney cell line) ATCC CRL-1573
Phoenix-ECO (HEK293-derived retroviral packaging line) ATCC CRL-3214
HeLa (human cervical cancer cell line) ATCC CCL-2
HeLa + pQCXIN-FLAP-PDS5BWT This paper N/A
HeLa + pQCXIN-FLAP-PDS5B4A This paper N/A
HeLa + pQCXIN-FLAG-MERIT40WT This paper N/A
HeLa + pQCXIN-FLAG-MERIT404A This paper N/A
Experimental Models: Organisms/Strains
Xenopus laevis N/A RRID:NXR 0.031
Recombinant DNA
pAAV-lacZ Agilent Cat# 240071
pRC Agilent Cat# 240071
pHelper Agilent Cat# 240071
pAAV-CDC7flox This paper N/A
pAAV-CDC7Δ This paper N/A
pVSV-G Takara Cat# PT3343-5
pcDNA5-FRT-TO-FLAP-DEST Jallepalli Lab (Maciejowski et al., 2017) N/A
pQCXIN Takara Cat# 631514
pQC7N This paper N/A
pQC7N-FLAP-Cdc7wt This paper N/A
pQC7N-FLAP-Cdc7as This paper N/A
MaRX-hygro-mKO2-Cdt1 (30-120) Gregory David (Bainor et al., 2018) N/A
pQCXIN Takara N/A
hCas9 expression vector George Church Addgene 41815
Empty gRNA vector George Church Addgene 41824
MERIT40 gRNA vector; target CCACCACCAGTGCAAACTCG This paper N/A
PDS5A gRNA vector; target GTGAGATCCTTCGCTAAATC This paper N/A
PDS5B gRNA vector; target GCTGCCTTGCTGATATTTTC This paper N/A
pQCXIN-HA-MERIT40WT This paper N/A
pQCXIN-HA-MERIT404A (S7A S8A T10A S20A) This paper N/A
pQCXIN-HA-MERIT40 ΔC (Δ1-20) This paper N/A
pQCXIN-FLAP-PDS5BWT This paper N/A
pQCXIN-FLAP-PDS5B4A This paper N/A
pJC1 (“floxed” bicistronic retroviral vector with mCherry, HA epitope tag, and blasticidin resistance) This paper N/A
pJC1-mCherry-HA-PDS5BWT This paper N/A
pJC1-mCherry-HA-PDS5B4A (S1407A S1408A S1417A S1418A) This paper N/A
pJC1-mCherry-HA-PDS5B ΔC (Δ1394-1447) This paper N/A
pDONR221 ThermoFisher 12536017
pDEST15-MERIT40WT (1-60) This paper N/A
pDEST15-MERIT404A (1-60 S7A S8A T10A S20A) This paper N/A
pDEST15-PDS5BWT (1391-1447) This paper N/A
pDEST15-PDS5B4A (1391-1447 S1407A S1408A S1417A S1418A) This paper N/A
pDEST15-CTF4WT (351-410) This paper N/A
pDEST15-CTF43A (351-410 S393A S394A S407A) This paper N/A
pDEST15-SETWT (1-49) This paper N/A
pDEST15-SET3A (1-49 S15A T23A S24A) This paper N/A
pDEST15-UBR5WT (1971-2000) This paper N/A
pDEST15-UBR52A (1971-2000 S1990A T1998A) This paper N/A
pDEST15-NEURL4WT (1071-1113) This paper N/A
pDEST15-NEURL45A (1071-1113 S1083A S1085A S1086A T1088A S1089A) This paper N/A
Software and Algorithms
BWA (Li and Durbin, 2010) https://github.com/lh3/bwa
Samtools (Li et al., 2009) http://www.htslib.org
MATLAB MathWorks N/A
MaxQuant (v1.0.14.7) (Cox and Mann, 2008) https://www.maxquant.org
MASCOT (v2.3.02) Matrix Science http://www.matrixscience.com/search_form_select.html
Perseus (Tyanova et al., 2016) https://maxquant.net/perseus/
Fiji (v2.0)
NIS Elements-AR (v5.41) Nikon Instruments https://www.microscope.healthcare.nikon.com/products/software/nis-elements/nis-elements-advanced-research
Prism (v7) GraphPad https://www.graphpad.com
Lasergene (v.14) DNASTAR https://www.dnastar.com