Table 1.

Breakpoint mapping results and gene content of the duplications

Family	Structural variant and breakpoint (GRCh38/hg38)	Size (bp)	Genes included in or affected by the duplication
ZD3/ZD346	NC_000016.10:g.54893325_55501091dup	607 766	protein-coding genes: IRX5, IRX6, MMP2 (exons 1–11/13) lincRNAs: CRNDE, CTD-3032H12, RP11-26 L20, MMP2-AS1
ZD178	NC_000016.10:g.54801236_55533834dup	732 598	protein-coding genes: IRX5, IRX6, MMP2, LPCAT2 (exons 1–6/14) lincRNAs: CRNDE, CTD-3032H12, RP11-26 L20, MMP2-AS1
RCD460	NC_000016.10:g.54716967_54716968ins [54716967_55565004; AGCTAACAAGTAATACCTAACAGTTATTCAGC]	848 069	protein-coding genes: IRX5, IRX6, MMP2, LPCAT2 (exons 1–11/14) lincRNAs: CRNDE, CTD-3032H12, RP11-26 L20, MMP2-AS1