| Gene | Smed ID | Forward primer | Reverse primer |
|---|---|---|---|
| piwi-1 | dd_Smed_v6_659_0_1 | gaccaagaagaggaggtctcc | gcgttcgcgaattctgtcatt |
| FoxA | dd_Smed_v6_10718_0_4 | aacgacctcaacggaatgttt | catgcgccaaagttaaggata |
| ovo | dd_Smed_v6_48430_0_1 | aatgcccacagatttgtc | cataaagtgaattcgggtg |
| myoD | dd_Smed_v6_12634_0_1 | ctattccggtccatactcagc | actcttgatcaactttcctcg |
| gata-4/5/6 | dd_Smed_v6_4075_0_1 | gtccgtaagatccacgatccg | tgattgaggaatagggcttcg |
| six-1/2 | dd_Smed_v6_9774_0_1 | ccttgtcagggatctaatcc | ggtgaggatgataagttggg |
| pax6a | dd_Smed_v6_17726_0_1 | ctgggcataaatcaaaccgc | cttgggggataaactgatcc |
| coe | dd_Smed_v6_9893_0_1 | cgaagagcagacaacagcac | ttttaccaacacccgattgc |
| laminin | dd_Smed_v6_8356_0_1 | agtcgctggcaaagtgcatct | aatgatgcgtggtatccacag |
| fst | dd_Smed_v6_9584_0_1 | cagtggtgtgcaatttagcgagttc | gcaggtattcttggtttcgtaattcg |
| ChAT | dd_Smed_v6_6208_0_1 | tcggttgctgaaggtattgca | ggcatatagcattctacacgg |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.