REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
anti-PARylation (rabbit polyclonal)	Trevigen	Cat# 4336-BPC-100; RRID:AB_2721257
anti-pan-ADPr binding reagent (rabbit monoclonal)	Millipore	Cat# MABE1016; RRID:AB_2665466
anti-PARylation (rabbit polyclonal)	Enzo Life Sciences	Cat# ALX-210-890A-0100; RRID: N/A
anti-MARylation (rabbit monoclonal)	Bonfiglio et al., 2020	AbD33204
anti-H3S10/28MAR (human polyclonal)	Bonfiglio et al., 2020	AbD33644
anti-histone H3 (rabbit polyclonal)	Millipore	Cat#: 07-690; RRID:AB_417398
anti-PARG (mouse monoclonal)	Millipore	Cat# MABS61; RRID:AB_10806473
anti-ARH3/ADPRH (rabbit polyclonal)	Atlas Antibodies	Cat#: HPA027104; RRID:AB_1060133
anti-PARP1 (rabbit monoclonal)	Abcam	Cat#: ab32138; RRID:AB_777101
anti-PARP2 (rabbit polyclonal)	Millipore	Cat# MABE18; RRID:AB_10807040
anti-PARP3 (rabbit polyclonal)	Proteintech	Cat# 11289-1-AP; RRID:AB_2283392
anti-γH2AX (rabbit polyclonal)	Abcam	Cat# ab2893; RRID:AB_303388
anti-H3S10P (rabbit polyclonal)	Abcam	Cat#: ab5176; RRID:AB_304763
anti-H3K9me3 (rabbit polyclonal)	Abcam	Cat#: ab8898; RRID:AB_306848
anti-H3K27ac (rabbit polyclonal)	Abcam	Cat# ab4729; RRID:AB_2118291
anti-β-tubulin (rabbit polyclonal)	Abcam	Cat# ab6046; RRID:AB_2210370
anti-H3K27me3 (mouse monoclonal)	Abcam	Cat# ab6002; RRID:AB_305237
anti-H3K9ac (rabbit monoclonal)	Cell Signaling	Cat# 9649; RRID:AB_823528
anti-H2AX (rabbit monoclonal)	Cell Signaling	Cat# 7631; RRID:AB_10860771
anti-HPF1 (rabbit polyclonal)	Gibbs-Seymour et al., 2016	N/A
anti-GAPDH (mouse monoclonal)	Millipore	Cat# MAB374; RRID:AB_2107445
anti-laminA (rabbit polyclonal)	Abcam	Cat# ab26300; RRID:AB_775965
anti-GFP (rabbit polyclonal)	Abcam	Cat# ab290; RRID:AB_303395
anti-BRCA1 (mouse monoclonal)	Millipore	Cat# OP92; RRID:AB_2750876
anti-BRCA2 (mouse monoclonal)	Millipore	Cat# OP95; RRID:AB_2067762
anti-FEN1 (rabbit polyclonal)	Abcam	Cat# ab17994; RRID:AB_444168
anti-CXXC5 (rabbit polyclonal)	Cell Signaling	Cat# 84546; RRID:AB_2800040
anti-PML (mouse monoclonal)	Santa Cruz	Cat# sc-996; RRID:AB_628162
anti-Hsp70 (mouse monoclonal)	Abcam	Cat# ab2787; RRID:AB_303300
anti-cyclin E1 (mouse monoclonal)	Cell Signaling	Cat# 4129; RRID:AB_2071200
anti-cyclin A (rabbit monoclonal)	Abcam	Cat# ab32798; RRID:AB_731777
anti-cyclin B1 (mouse monoclonal)	Millipore	Cat# 05-373; RRID:AB_309701
anti-PRC1-phospho-T481 (rabbit monoclonal)	Abcam	Cat# ab62366; RRID:AB_944969
anti-PRC1 (rabbit polyclonal)	Gruneberg et al., 2006	N/A
Goat polyclonal anti-mouse, HRP-conjugated	Agilent	Cat# P0447; RRID:AB_2617137
Swine polyclonal anti-rabbit, HRP-conjugated	Agilent	Cat# P0399; RRID:AB_2617141
Goat polyclonal anti-human, HRP-conjugated	Bio-Rad	Cat# STAR126P; RRID:AB_1605087
Goat polyclonal anti-rabbit, Alexa Fluor 488-conjugated	Thermo Fisher Scientific	Cat# A-11034; RRID:AB_2576217
Biological samples
Control primary human fibroblasts	This paper	N/A
ARH3 C26F patient-derived primary human fibroblasts	This paper	N/A
Chemicals, peptides, and recombinant proteins
PARG inhibitor PDD00017273	Sigma	Cat# SML1781
Olaparib	Cayman Chemical	Cat# 10621
Veliparib	Enzo Life Sciences	Cat# ALX-270-444-M005
Thymidine	CalBiochem	Cat# 6060
PolyFect Transfection Reagent	QIAGEN	Cat# 301105
TransIT-LT1 Transfection Reagent	Mirus Bio	Cat# MIR 2300
Puromycin	InvivoGen	Cat# ant-pr-1
Blasticidin	InvivoGen	Cat# ant-bl-1
cOmplete, EDTA-free Protease Inhibitor Cocktail	Sigma	Cat# 11873580001
PhosSTOP	Sigma	Cat# 4906845001
Benzonase	Sigma	Cat# 1016970001
4x NuPAGE LDS sample buffer	Invitrogen	Cat# NP0007
TCEP	Sigma	Cat# 646547
NuPAGE Novex 4-12% Bis-Tris gel	Invitrogen	Cat# WG1402A
Trichostatin A	Sigma	Cat# T8552
Formic acid LC/MS grade	Honeywell Fluka	Cat#15667520
Acetonitrile LC/MS grade	ROTISOLV	Cat# AE70.2
G-148 solution	Sigma	Cat# G8168
Activated DNA	Trevigen	Cat# 4671-096-06
NAD+	Trevigen	Cat# 4684-096-02
32PNAD+	Perkin Elmer	Cat# BLU023X250UC
Histone H3 peptide (1-21) Ac-ARTKQTARKS TGGKAPRKQLAGGK(Biotin)-Am	AnaSpec	Cat# AS-61702
Histone H3 (1-21) S10MAR peptide Ac-ARTKQTARKS(ADPr)TGGKAPRKQLAGGK(Biotin)-Am	A gift from Ivan Matic	N/A
Recombinant human PARP1 protein	Langelier et al., 2011	N/A
Recombinant human H3/H4 tetramer	Mehrotra et al., 2011	N/A
Recombinant human HPF1 protein	Gibbs-Seymour et al., 2016	N/A
Recombinant human ARH3 protein	Fontana et al., 2017	N/A
Recombinant human PARG protein	Dunstan et al., 2012	N/A
Alkaline phosphatase	Sigma	Cat# 10713023001
Phosphodiesterase	Fisher Scientific	Cat# 15838401
Calf thymus DNA	Sigma	Cat# D4764
DAPI	Sigma	Cat# D9542
Hoechst 33342	Invitrogen	Cat# H3570
Deposited data
RNA-sequencing data	This study	GEO: GSE167060
Original imaging data	This study	https://doi.org/10.17632/zbmchm3fz4.1
Critical commercial assays
NAD+/NADH Quantification Colorimetric Kit	BioVision	Cat# K337
QuikChange Lightning Site-Directed Mutagenesis Kit	Agilent	Cat# 210519
Lipofectamine RNAiMAX Reagent	Invitrogen	Cat# 13778150
PolyFect Transfection Reagent	QIAGEN	Cat# 301105
TransIT-LT1 Transfection Reagent	Mirus Bio	Cat# MIR 2305
GFP-Trap Magnetic Agarose	Chromotek	Cat# gtma-20
Click-iT Plus EdU Alexa Fluor 647 Flow Cytometry Assay Kit	Invitrogen	Cat# C10419
Tel C-Alexa Fluor 488 PNA probe	PNA Bio	Cat# F1004
High Pure microRNA Isolation kit	Sigma	Cat# 5080576001
Subcellular Protein Fractionation kit for Cultured Cells	Thermo Fisher Scientific	Cat#78840
Direct-zol RNA Miniprep Plus Kit	Zymo Research	Cat# R2071
NEBNext Ultra II Directional RNA library prep kit	New England Biolabs	Cat# E7765
NovaSeq 6000 S4 Reagent Kit v1.5	Illumina	Cat# 20028312
LR Clonase II enzyme mix	Invitrogen	Cat# 11791020
Experimental models: cell lines
Human: U2OS cells	ATCC	Cat# HTB-96
Human: U2OS ARH3 KO cells	Fontana et al., 2017	N/A
Human: U2OS ARH3 KO cells complemented with untagged ARH3 WT	This paper	N/A
Human: U2OS ARH3 KO cells complemented with untagged ARH3 D77/78N	This paper	N/A
Human: HeLa cells	ATCC	Cat# CCL-2
Human: HeLa ARH3 KO cells	This paper	N/A
Human: 293T cells	ATCC	Cat# CRL-3216
Human: 293T ARH3 KO cells	Hanzlikova et al., 2020	N/A
Human: SUM159PT cells	BioIVT	RRID:CVCL_5423
Human: SUM159PT ARH3 KO cells	This paper	N/A
Human: SUM149PT cells	BioIVT	RRID:CVCL_3422
Human: SUM149PT ARH3 KO cells	This paper	N/A
Human: U251 cells	Sigma	Cat# 09063001
Human: U251 ARH3 KO cells	This paper	N/A
ARH3 C26F patient-derived primary human fibroblasts complemented with untagged ARH3 WT	This paper	N/A
ARH3 C26F patient-derived primary human fibroblasts complemented with untagged ARH3 D77/78N	This paper	N/A
Oligonucleotides
sgRNA 210 GCGCTGCTCGGGGACTGCGT	Invitrogen	N/A
sgRNA 212 GGGCGAGACGTCTATAAGGC	Invitrogen	N/A
Silencer Select Negative Control No. 1 siRNA	Invitrogen	Cat# 4390843
Silencer Select HPF1 siRNA	Invitrogen	Cat# s29883
Silencer Select PARG siRNA	Invitrogen	Cat# s16159
Silencer Select Negative Control No. 2 siRNA	Invitrogen	Cat# 4390847
Silencer Select BRCA1 siRNA	Invitrogen	Cat# s458
BRCA2 siRNA GAAGAAUGCAGGUUUAAUA	Dharmacon	Cat# D-003462-04
Recombinant DNA
pDONR221 (Gateway vector)	Invitrogen	Cat# 12536017
pDEST12.2 (Gateway vector)	Invitrogen	Cat# 11808-011
pDEST12.2-ARH3 WT (plasmid)	This paper	N/A
pDEST12.2-ARH3 D77/78N (plasmid)	This paper	N/A
pLX304 (plasmid)	Addgene	Cat# 25890
pLX304-ARH3 WT (plasmid)	This paper	N/A
pLX304-ARH3 D77/78N (plasmid)	This paper	N/A
pCMV-VSV-G (plasmid)	Addgene	Cat# 8485
pCMV-dR8.2 (plasmid)	Addgene	Cat #8455
H3.1-GFP (plasmid)	Hanzlikova et al., 2020	N/A
pDEST-YFP (Gateway vector)	Invitrogen	Cat# V35820
pDEST-YFP-PARP1 (plasmid)	Gibbs-Seymour et al., 2016	N/A
Software and algorithms
ImageJ	NIH	N/A
FlowJo	BD Biosciences	N/A
CellProfiler	McQuin et al., 2018	N/A
Cutadapt v1.18	Martin, 2011	N/A
STAR v2.7.3a	Dobin et al., 2013	N/A
SAMtools v1.19	Li et al., 2009	N/A
deepTools v.3.4.2	Ramírez et al., 2016	N/A
HTseq-count v0.11.3	Anders et al., 2015	N/A
DESeq2 v3.12	Love et al., 2014	N/A
GSEA v.4.1.0	Mootha et al., 2003; Subramanian et al., 2005	N/A
Prism 7	GraphPad	N/A