KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Alexa-647 rat anti-mouse NKp46 (clone 29A1.4) | BD Biosciences | Cat# 560755; RRID:AB_1727464 |
| APC mouse anti-mouse NK1.1 (clone PK136) | BD Biosciences | Cat#550627; RRID:AB_398463 |
| APC/Cyanine7 anti-mouse CD19 (clone 6D5) | Biolegend | Cat# 115530; RRID:AB_830707 |
| APC-Cy7 Hamster Anti-Mouse CD11c (Clone HL3) | BD Biosciences | Cat# 561241; RRID:AB_10611727 |
| APC-Cy7 hamster anti-mouse CD3epsilon (clone 145-2C11) | Biolegend | Cat# 100330; RRID:AB_1877170 |
| BV421 hamster anti-mouse CD3epsilon (clone 145-2C11) | Biolegend | Cat# 100336; RRID:AB_11203705 |
| BV421 mouse anti-mouse CD45.1 (clone A20) | BioLegend | Cat#110732; RRID:AB_2562563 |
| BV421 mouse anti-mouse NK1.1 (clone PK136) | BD Biosciences | Cat# 562921; RRID:AB_2728688 |
| BV421 rat anti-mouse Ly49H (clone 3D10) | BD Biosciences | 744260; RRID:AB_2742099 |
| BV421 hamster anti-mouse CD49a (clone Ha31/8) | BD Biosciences | Cat# 740046; RRID:AB_2739815 |
| BV605 NKG2A/C/E (clone 20d5) | BD Biosciences | Cat#564382; RRID:AB_2738782 |
| Mouse anti-mouse Ly49C+I (clone 5e6) | BD Biosciences | Cat#553277; RRID:AB_394751 |
| PE goat anti-rabbit F(ab’)2 (polyclonal) | Cell Signaling Technologies | Cat# 8885; RRID:AB_2797677 |
| PE hamster anti-mouse CD3epsilon (clone 145-2C11) | Biolegend | Cat# 100308; RRID:AB_312673 |
| PE mouse anti-mouse BRDU (clone 3D4) | BD Biosciences | Cat# 556029; RRID:AB_396305 |
| PE mouse anti-mouse phospho-MTOR (clone MRBBY) | ThermoFisher | Cat# 12-9718-42; RRID:AB_2572724 |
| PE rat anti-mouse (clone XMG1.2) | BioLegend | Cat#505808; RRID:AB_315402 |
| PE rat anti-mouse CD107a (clone 1D4B) | BD Biosciences | Cat# 558661; RRID:AB_1645247 |
| PE rat anti-mouse CD11b (clone M1/70) | BD Biosciences | Cat#557397; RRID:AB_396680 |
| PE rat anti-mouse Ly49H (clone 3D10) | BioLegend | Cat#144705; RRID AB_2561673 |
| PE Annexin V (Ca2+ dependent phospholipidbinding protein) | BD Biosciences | Cat# 556421; RRID:AB_2869071 |
| PE-Cy7 hamster anti-mouse CD27 (clone LG.3A10) | BD Biosciences | Cat#563604; RRID:AB_2738309 |
| PE-Cy7 mouse anti-mouse CD45.1 (clone A20) | BioLegend | Cat# 110730; RRID:AB_1134168 |
| PE-Cy7 rat anti-mouse Ly49H (clone 3D10) | Biolegend | 144714; RRID:AB_2783113 |
| PE-Cy7 rat anti-mouse CD127 (clone A7R34) | Biolegend | Cat# 135014; RRID:AB_1937265 |
| PerCP/Cyanine5.5 anti-mouse DX5 (clone CD49b) | Biolegend | Cat# 108916; RRID:AB_2129358 |
| PerCP-Cy5.5 hamster anti-mouse CD3epsilon (clone 145-2C11) | Biolegend | Cat# 100328; RRID:AB_893318 |
| Rat anti mouse CD226/DNAM-1 (clone 10E5) | BioLegend | Cat#128806; RRID:AB_1186119 |
| Rat anti-mouse NKG2D (clone CX5) | BioLegend | Cat# 130212; RRID:AB_1236372 |
| Unconjugated mouse anti-mouse NK1.1 (PK136) | BioXcell | Cat# BE0036; RRID:AB_1107737 |
| Unconjugated rabbit anti-human phospho-AMPK-alpha (clone 40H9) | Cell Signaling Technologies | Cat# 2535; RRID:AB_331250 |
| Unconjugated rat anti-mouse CD16 (clone 2.4g2) | ATCC | ATCC Cat# HB-197; RRID:CVCL_9148 |
| Unconjugated anti-mouse Ly49H (clone 3D10) | Biolegend | Cat# 144702; RRID:AB_2561549 |
| Bacterial and virus strains | ||
| Murine cytomegalovirus (MCMV) | ATCC | Cat#ATCC VR-1399 |
| Chemicals, peptides, and recombinant proteins | ||
| 7-AAD (7-Amino Actinomycin D) | Millipore-Sigma | Cat# 129935 |
| BD Cytofix/cytoperm | BD Biosciences | Cat# 554714 |
| BrdU | MilliporeSigma | Cat# B5002 |
| Brefeldin A | BD Biosciences | Cat# 555029 |
| Draq5 | Cell Signaling | Cat# 4084S |
| GolgiStop (monensin) | BD Biosciences | Cat #: 554724 |
| Mouse recombinant IL-12 | PeproTech | Cat# 210-12 |
| Mouse recombinant IL-15 | Stem Cell | Cat# 78080.1 |
| Mouse recombinant IL-18 | MBL | Cat#B002-5 |
| Tag-it Violet | BioLegend | Cat# 425101 |
| Tamoxifen Chow | Envigo | Cat# TD.130856 |
| Zombie Yellow | Biolegend | Cat# 423104 |
| Critical commercial assays | ||
| ATPLite Luminescence Assay | Perkin Elmer | Cat# 6016941 |
| BrdU Assay | BD Biosciences | Cat# 552598 |
| COX assay | MilliporeSigma | Cat# CYTOCOX1 |
| cytochrome c | MilliporeSigma | Cat #: C3131 |
| Dithiothreitol (DTT) | MilliporeSigma | Cat #: D0632 |
| Gentra Puregene Tissue Kit | QIAGEN | Cat# 158667 |
| Mouse NK cell Enrichment (EasySep) | StemCell | Cat# 19855 |
| N-dodecyl-B-D-Maltoside | MilliporeSigma | Cat #: D4641 |
| RNA Easy kit | QIAGEN | Cat# 74104 |
| Seahorse XF Cell Mito Stress Test Kit | Agilent | Cat #: 103015-100 |
| Deposited data | ||
| Single cell RNA sequencing raw data | This paper | GSE149659 |
| Experimental models: Cell lines | ||
| YAC1 | ATCC | ATCC TIB-160; RRID CVCL_2244 |
| Ba/F3-m157 cells | W. Yokoyama | Smith et al., 2002 |
| Experimental Models: Organisms/Strains | ||
| Mouse: Cox10Δ/Δ; B6.129X1-Cox10tm1Ctm/J | The Jackson Laboratory | Cat# 024697; RRID IMSR_JAX:024697 |
| Mouse: YFP reporter; B6.129X1-Gt(ROSA) 26Sortm1(EFYP)Cos/J | The Jackson Laboratory | Cat# 006148; RRID IMSR_JAX:006148 |
| Mouse: B6.Bxd8; B6.BXD8-Klra8Cmv1-del/WumJ | The Jackson Laboratory | Cat# 008633; RRID IMSR_JAX:008633 |
| Mouse: Rag2−/−γc−/−; B10;B6-Rag2tm1Fwa Il2rgtm1Wjl | Taconic | Cat# 4111; RRID IMSR_TAC:4111 |
| Mouse: cNcr1; Tg(Ncr1-icre)265Sxl | Eckelhart et al., 2011 | MGI ID: 4941472 |
| Mouse: Ly5.1; B6.SJL-PtprcaPepcb/BoyCrCrl | Charles River | Cat# 564, RRID IMSR_CRL:564 |
| Mouse: Ncr1-iCreERT2 | Wagner et al., 2020 | N/A |
| Oligonucleotides | ||
| Beta actin primer/probe set | Thermofisher | Cat# 4352341E |
| COX10 primer/probe set | Thermofisher | Cat# Mm00617695_m1 |
| MCMV (IE1) primer/probe set Primer 1 CCCTCTCCTAACTCTCCCTTT | IDT Custom PrimeTime Probe Parikh et al., 2015 | N/A |
| MCMV (IE1) primer/probe set Primer 2 TGGTGCTCTTTTCCCGTG | IDT Custom PrimeTime Probe Parikh et al., 2015 | N/A |
| MCMV (IE1) primer/probe set Probe FAM TCTCTTGCCCCGTCCTGAAAACC | IDT Custom PrimeTime Probe Parikh et al., 2015 | N/A |
| Software and algorithms | ||
| Flowjo 10.7.1 | Flowjo | https://www.flowjo.com/solutions/flowjo/downloads |
| ImmGen | Heng et al., 2008 | https://www.immgen.org |
| Metascape | Zhou et al., 2019 | http://metascape.org |
| Prism 9 | Graphpad | N/A |
| QuantStudios3 | Thermofisher | Cat# A28136 |
| Seurat 3.0 for R | Stuart et al., 2019 | https://satijalab.org/seurat/ |