Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Homo sapiens) | STK11 | GenBank | Gene ID: 6794 | This gene is commonly known as LKB1 in the field |
| Gene (Homo sapiens) | CRTC1 | GenBank | Gene ID: 23373 | |
| Gene (Homo sapiens) | CRTC2 | GenBank | Gene ID: 200186 | |
| Gene (Homo sapiens) | CRTC3 | GenBank | Gene ID: 64784 | |
| Gene (Homo sapiens) | NR4A2 | GenBank | Gene ID: 4929 | |
| Gene (Homo sapiens) | INSL4 | GenBank | Gene ID: 3641 | |
| Gene (Homo sapiens) | LINC00473 | GenBank | Gene ID: 90632 | |
| Gene (Homo sapiens) | PDE4D | GenBank | Gene ID: 5144 | |
| Cell line (Homo-sapiens) | A549 | ATCC | CCL-185 | |
| Cell line (Homo-sapiens) | H157 | ATCC | CRL-5802 | |
| Cell line (Homo-sapiens) | H322 | ATCC | CRL-5806 | |
| Cell line (Homo-sapiens) | H522 | ATCC | CRL-5810 | |
| Cell line (Homo-sapiens) | H2126 | ATCC | CCL-256 | |
| Cell line (Homo-sapiens) | H1819 | ATCC | CRL-5897 | |
| Cell line (Homo-sapiens) | H2087 | ATCC | CRL-5922 | |
| Cell line (Homo-sapiens) | H2009 | ATCC | CRL-5911 | |
| Cell line (Homo-sapiens) | H3123 | Frederic J Kaye lab | CVCL_Y295 PMID:11030152 |
|
| Cell line (Homo-sapiens) | H23 | ATCC | CRL-5800 | |
| Cell line (Homo-sapiens) | H460 | ATCC | HTB-177 | |
| Cell line (Homo-sapiens) | H2122 | ATCC | CRL-5985 | |
| Cell line (Homo-sapiens) | H358 | ATCC | CRL-5807 | |
| Cell line (Homo-sapiens) | BEAS-2B | ATCC | CRL-9609 | |
| Cell line (M. musculus) | mLSCCLP | Francesco J DeMayo lab | PMID:31089135 | |
| Antibody | anti-CRTC1 (Rabbit Polyclonal) | Rockland Immunochemicals Inc | Cat: #600-401-936 | WB 1:1000 |
| Antibody | anti-CRTC1 (Rabbit Polyclonal) | Bethyl Laboratories | Cat: #A300-769A | ChIP 3 ug/ml |
| Antibody | anti-CRTC2 (Rabbit Polyclonal) | Bethyl Laboratories | Cat: #A300-637A | WB 1:1000 ChIP 3 ug/ml |
| Antibody | anti-CRTC3 (Rabbit Polyclonal) | Bethyl Laboratories | Cat: #A302-703A, | ChIP 3 ug/ml |
| Antibody | anti-CRTC3 (Rabbit monoclonal) | Cell Signaling Technology | Cat: #2720 | WB 1:1000 |
| Antibody | anti-LKB1 (Rabbit monoclonal) | Cell Signaling Technology | Cat: #3050 | WB 1:1000 |
| Antibody | anti-β-TUBULIN (Rabbit monoclonal) | Epitomics | Cat: #1878 | WB 1:2000 |
| Antibody | anti-HDCA1 (Rabbit Polyclonal) | Santa Cruz Biotechnology | Cat: #sc7872 | WB 1:2000 |
| Antibody | anti-β-ACTIN (Mouse monoclonal) | Sigma-Aldrich | Cat: #A5316 | WB 1:2000 |
| Recombinant DNA reagent | lentiCRISPR v2 (plasmid) | Addgene | Plasmid #52961 | |
| Recombinant DNA reagent | sgCtr- LentiCRISPRv2 (plasmid) | Addgene | Plasmid #107402 | |
| Recombinant DNA reagent | sgCRTC1- lentiCRISPR v2 (plasmid) | This paper | sgRNA sequence cloned into lentiCRISPR v2 | |
| Recombinant DNA reagent | sgCRTC2- lentiCRISPR v2 (plasmid) | This paper | sgRNA sequence clone into lentiCRISPR v2 | |
| Recombinant DNA reagent | sgCRTC3- lentiCRISPR v2 (plasmid) | This paper | sgRNA sequence clone into lentiCRISPR v2 | |
| Recombinant DNA reagent | pMSCV-GFP (plasmid) | Addgene | Plasmid #86537 | |
| Recombinant DNA reagent | pMSCV-dnCRTC (plasmid) | This paper | dnCRTC sequence cloned into pMSCV-GFP | |
| Recombinant DNA reagent | pcDNA FLAG TORC1 (plasmid) | Addgene | Plasmid #25718 | |
| Recombinant DNA reagent | pcDNA FLAG TORC2 (plasmid) | Addgene | Plasmid #22975 | |
| Recombinant DNA reagent | pcDNA FLAG TORC3 (plasmid) | Addgene | Plasmid #22976 | |
| Recombinant DNA reagent | lentiCas9-Blast (plasmid) | Addgene | Plasmid #52962 | |
| Recombinant DNA reagent | non-targeting control gRNA (plasmid) | Addgene | Plasmid #80180 | |
| Recombinant DNA reagent | STK11 gRNA-1 (plasmid) | Addgene | Plasmid #75912 | |
| Recombinant DNA reagent | STK11 gRNA-2 (plasmid) | Addgene | Plasmid #75913 | |
| Recombinant DNA reagent | pMD2.G (plasmid) | Addgene | Plasmid #12259 | Lentiviral Envelope |
| Recombinant DNA reagent | psPAX2 (plasmid) | Addgene | Plasmid #12260 | Lentiviral Packaging |
| Sequence-based reagent | CRTC1-qRT-F | This paper | qPCR primers | TGTCTCTCTGACCCCCTTCCAATCC |
| Sequence-based reagent | CRTC1-qRT-R | This paper | qPCR primers | GTCCGCGGGTGGTGAGAGGTA |
| Sequence-based reagent | CRTC2-qRT-F | This paper | qPCR primers | AGCCCCCTGAGTTTGCTCGC |
| Sequence-based reagent | CRTC2-qRT-R | This paper | qPCR primers | TGGGGGTAACCGCTGGTCAGT |
| Sequence-based reagent | CRTC3-qRT-F | This paper | qPCR primers | TGACCAGCAGTCCATGAGGCCA |
| Sequence-based reagent | CRTC3-qRT-R | This paper | qPCR primers | GGTCTTTGAACAGGCTGGTGCTGG |
| Sequence-based reagent | LINC00473-qRT-F | This paper | qPCR primers | AAACGCGAACGTGAGCCCCG |
| Sequence-based reagent | LINC00473-qRT-R | This paper | qPCR primers | CGCCATGCTCTGGCGCAGTT |
| Sequence-based reagent | FOS-qRT-F | This paper | qPCR primers | CACTCCAAGCGGAGACAG |
| Sequence-based reagent | FOS-qRT-R | This paper | qPCR primers | AGGTCATCAGGGATCTTGCAG |
| Sequence-based reagent | NR4A2-qRT-F | This paper | qPCR primers | GCCGGAGAGGTCGTTTGCCC |
| Sequence-based reagent | NR4A2-qRT-R | This paper | qPCR primers | AGGGTTCGCCTGGAACCTGGAA |
| Sequence-based reagent | INSL4-qRT-F | This paper | qPCR primers | GATGTGGTCCCCGATTTGGA |
| Sequence-based reagent | INSL4-qRT-R | This paper | qPCR primers | AGGTTGACACCATTTCTTTGGG |
| Sequence-based reagent | CPS1-qRT-F | This paper | qPCR primers | CTGATGCTGCCCACACAAAC |
| Sequence-based reagent | CPS1-qRT-R | This paper | qPCR primers | AGGGGAAGGATCGAGAAGCT |
| Sequence-based reagent | PDK4-qRT-F | This paper | qPCR primers | ACAGACAGGAAACCCAAGCC |
| Sequence-based reagent | PDK4-qRT-R | This paper | qPCR primers | GTTCAACTGTTGCCCGCATT |
| Sequence-based reagent | NR4A1-qRT-F | This paper | qPCR primers | GAGTCCCAGTGGCGGAGGCT |
| Sequence-based reagent | NR4A1-qRT-R | This paper | qPCR primers | CAGGCTGCACCCTACCCGGC |
| Sequence-based reagent | TM4SF20-qRT-F | This paper | qPCR primers | TCCAGGCTCTCTTAAAAGGTCC |
| Sequence-based reagent | TM4SF20-qRT-R | This paper | qPCR primers | ATGGTGTCGTTACTGGTGGG |
| Sequence-based reagent | NR4A3-qRT-F | This paper | qPCR primers | GAAGAGGGCAGCCCGGCAAG |
| Sequence-based reagent | NR4A3-qRT-R | This paper | qPCR primers | ACGCAGGGCATATCTGGAGGGT |
| Sequence-based reagent | PTGS2-qRT-F | This paper | qPCR primers | GTTCCCACCCATGTCAAAAC |
| Sequence-based reagent | PTGS2-qRT-R | This paper | qPCR primers | CCGGTGTTGAGCAGTTTTCT |
| Sequence-based reagent | SIK1-qRT-F | This paper | qPCR primers | AGCTTCTGAACCATCCACACA |
| Sequence-based reagent | SIK1-qRT-R | This paper | qPCR primers | TTTGCCAGAACTTCTTCCGC |
| Sequence-based reagent | PDE4B-qRT-F | This paper | qPCR primers | CCGATCGCATTCAGGTCCTTCGC |
| Sequence-based reagent | PDE4B-qRT-R | This paper | qPCR primers | TGCGGTCTGTCCATTGCCGA |
| Sequence-based reagent | PDE4D-qRT-F | This paper | qPCR primers | AACACATGAATCTACTGGCTGA |
| Sequence-based reagent | PDE4D-qRT-R | This paper | qPCR primers | TCACACATGGGGCTTATCTCC |
| Sequence-based reagent | GAPDH-qRT-F | This paper | qPCR primers | CAATGACCCCTTCATTGACC |
| Sequence-based reagent | GAPDH-qRT-R | This paper | qPCR primers | GACAAGCTTCCCGTTCTCAG |
| Sequence-based reagent | ID1-qRT-F | This paper | qPCR primers | TTCTCCAGCACGTCATCGAC |
| Sequence-based reagent | ID1-qRT-R | This paper | qPCR primers | CTTCAGCGACACAAGATGCG |
| Sequence-based reagent | LINC00473 promotor-qRT-F | This paper | qPCR primers | CTACAGACGTCATCGCCTCC |
| Sequence-based reagent | LINC00473 promotor-qRT-R | This paper | qPCR primers | CACATTTGGGGGTGCTTGTG |
| Sequence-based reagent | NR4A2 promoter-qRT-F | This paper | qPCR primers | GGGGAAAGTGAAGTGTCG |
| Sequence-based reagent | NR4A2 promoter-qRT-R | This paper | qPCR primers | CCGCGCTCGCTTTGGTAT |
| Sequence-based reagent | sgCRTC1-A | This paper | gRNA targets | TGGCGACTTCGAACAATCCG |
| Sequence-based reagent | sgCRTC1-B | This paper | gRNA targets | TTACCCGCGCGGCCCGCGTC |
| Sequence-based reagent | sgCRTC1-C | This paper | gRNA targets | CCCAGCCGAGGCCAGTACTA |
| Sequence-based reagent | sgCRTC2-A | This paper | gRNA targets | GCAGCGAGATCCTCGAAGAA |
| Sequence-based reagent | sgCRTC2-B | This paper | gRNA targets | AGGATATGTGGCGGGTGTAT |
| Sequence-based reagent | sgCRTC2-C | This paper | gRNA targets | ACAGGCCCAAAAACTGCGAC |
| Sequence-based reagent | sgCRTC3-A | This paper | gRNA targets | CTGACGCACTGCTCCGCAGC |
| Sequence-based reagent | sgCRTC3-B | This paper | gRNA targets | AAAAAGGATATTTGTCGCCC |
| Sequence-based reagent | sgCRTC3-C | This paper | gRNA targets | AACCCGCCATCACGGGCTGG |
| Sequence-based reagent | sg-Ctr | This paper | gRNA targets | CTTCCGCGGCCCGTTCAA |
| Commercial assay or kit | Bronchial Epithelial Cell Growth Medium kit | Lonza | Cat: # CC-4175 | BEAS-2B cell culture |
| Commercial assay or kit | Effectene Transfection Reagent | QIAGEN | Cat: #301425 | Transfection |
| Commercial assay or kit | RNeasy Mini Kit | QIAGEN | Cat: #74106 | RNA extraction |
| Commercial assay or kit | cDNA Reverse Transcription Kit | Applied Biosystems | Cat: #4368814 | |
| Commercial assay or kit | SYBR Green Supermix | Bio-Rad | Cat: #1725120 | |
| Commercial assay or kit | Alkaline Phosphatase, Calf Intestinal | New England BioLabs | Cat: #M0290 | |
| Commercial assay or kit | Nuclear and Cytoplasmic Extraction Reagents | Thermo Scientific | Cat: #78833 | |
| Commercial assay or kit | West Dura Extended Duration Substrate | Thermo Scientific | Cat: # 34076 | |
| Commercial assay or kit | GFP-Trap Magnetic Agarose | ChromoTek | Cat:# #gtma-10 | |
| Commercial assay or kit | VeriBlot for IP Detection Reagent | abcam | Cat:# ab131366 | |
| Commercial assay or kit | Dual-Luciferase Reporter Assay System | Promega | Cat:# E1910 | |
| Commercial assay or kit | FITC Annexin V Apoptosis Detection Kit | BD Bioscience | Cat: #556547 | |
| Chemical compound, drug | Hexadimethrine bromide | Sigma-Aldrich | Cat: # H9268 | polybrene |
| Chemical compound, drug | Puromycin Dihydrochloride | Gibco | Cat: #A1113803 | |
| Chemical compound, drug | Matrigel | Corning | Cat: #356231 | |
| Chemical compound, drug | D-Luciferin | PerkinElmer | Cat: #122799 | |
| Software, algorithm | GraphPad Prism 7 | GraphPad Prism | ||
| Software, algorithm | ImageJ software | ImageJ |