An Easy Multiplex PCR-SSP Assay for the Genotyping of KEL1 and KEL2 in Multi-transfused Patients

Abstract

Kell blood group system consists of 34 antigens. KEL1 and KEL2 are the most clinically important antigens of this system, causing hemolytic disease of the fetus and newborn (HDFN) and transfusion reaction. A total of 200 samples from blood donors were tested serologically for the presence of KEL1 and KEL2 antigens on erythrocytes. Genomic DNA was analyzed by PCR-SSP method to determine the Kell genotype. A multiplex PCR-SSP assay was designed and tested to genotype KEL1/KEL2 alleles in a single reaction. PCR genotyping revealed samples as; KEL2/KEL2 (93.5%) and KEL1/KEL2 (6.5%), while no sample determined as KEL1/KEL1. A 100% concordance observed between PCR and serological results. Multiplex PCR accurately diagnosed Kell genotype. Kell blood group genotyping by PCR-SSP can be used as an alternative method, especially in multi-transfused patients where serological findings are ambiguous.

Introduction

The Kell blood group system is one of the most clinically important systems in transfusion medicine. So far 35 antigens have been recognized in this system such as K/k (KEL1/KEL2), Kp^a/Kp^b (KEL3/KEL4), and Js^a/Js^b (KEL6/KEL7) [1]. Alloantibodies to Kell antigens can cause transfusion reactions in patients with transfusion complications and hemolytic disease of the fetus and newborn (HDFN). In this anemia, fetal red blood cells are coated with maternal IgG antibodies that cross the placenta and lysed in the spleen and liver of the fetus [2]. The fetal-neonatal hemolytic anemia is classified into three categories; ABO system, Rh system and other blood groups including Kell, Duffy and kid [3].

KEL1 is highly immunogenic and may cause an antibody response in KEL1-negative people receiving KEL1-positive blood. This is especially the case with patients who are on regular transfusion such as thalassemic individuals because donated blood is not routinely typed for Kell antigens [4].

In blood banks, Kell antigens are determined by serology using specific antibodies. In multi-transfused patients, who receive several units of blood in a short time, detection of Kell antigens is problematic. So, genotyping of genomic DNA with KEL1 and KEL2 allele-specific primers are promising [5].

Single nucleotide polymorphisms (SNP) are considered to be the most common cause of KELL phenotypes. KEL1 differs from KEL2 in single amino acids. The 578C/T polymorphism (rs8176058) in exon6 results in either Met (KEL1) or Thr (KEL2) in position 193 of protein [6].

In a comprehensive study, anti-K was found in 127 out of 127,076 pregnancies. (% 0.1).Thirteen cases of pregnancies with maternal anti-K gave birth to K+, 5 (38%) of them had severe HDN. Anti-k appears to be further induced by blood transfusions [7].

Here we aimed genotyping of two clinically important Kell blood group alleles with PCR-SSP assay. We also designed and tested a multiplex PCR-SSP to assist in situations, like multi-transfused patients, where serology results are ambiguous.

Materials and Methods

This study was approved by the ethical committee of the High institute for research and education in transfusion medicine. After obtaining written consent, a total of 200 EDTA-anticoagulated blood samples were collected from blood donors of Tehran blood center. All samples were tested negative for viral markers, i.e. HIV-1/2, HBV, and HCV. RBCs were analyzed serologically for the presence of KEL1 and/or KEL2 antigens by specific antisera (Immunodiagnostika, Eschelbronn, Germany) following manufacturer’s instructions. Genomic DNA was extracted by a commercial assay (GeNet Bio; Daejeon, Korea) according to the manufacturer’s instruction. Specific primers were designed for KEL1, KEL2, and exon 6 of the Kell gene. The sequences of primers and their annealing temperature have been shown in Table 1. PCR-SSP reactions were performed using a commercial PCR mix (Parstous, Tehran, Iran) in a final volume of 20 µl. Each reaction contained 10 µl of PCR mix, 50 ng of DNA, and 0.1 µM of each of primers. Thermal cycling was started by an initial soak in 95 °C for 5 min followed by 35 cycles of 94 °C for 30 s, annealing temperature (Tables 1, 2) for 30 s, and 72 °C for 45 s. PCR products were analyzed by electrophoresis in 1.5% of agarose gel and visualized by Green viewer (Parstous, Tehran, Iran) under UV illumination. Exon 6 of the Kell gene was amplified and sequenced by specific primers (Table 2).

Table 1.

Primers used in genotyping of KEL1 and KEL2

Primer	Sequence	Annealing	Length (bp)
K578T	GACTTCCTTAAACTTTAACCGCAT	56	140
K578C	GGACTTCCTTAAACTTTAACCGCAC		141
Kell-Ra	CGCCAGTGCATCCCTCACC

^aKell-r is the common primer in both reactions

Table 2.

Primers used in multiplex PCR

Primer	Sequence	Annealing	Length (bp)
KEL1	ACTCATCAGAAGTCTCAGGT	58	134
KEL2	GACTTCCTTAAACTTTAACCGATC		198
KEX6-Fa	TGCAACCTTCCTCTAAGGGATGA		290
KEX6-Ra	AGACAATGGGGGATGGGCTC

^aKEX6-F and KEX6-R primers were also used for sequencing reaction

Results

The result of serological phenotyping and molecular genotyping revealed 100% concordance between the two methods (Table 3). None of the samples showed KEL1/KEL1 distribution. Multiplex PCR accurately detected both alleles in a single reaction (Fig. 1). The results of PCRs were validated by sequencing of exon 6 of the gene.

Table 3.

Results of serological and molecular analysis of KEL1 and KEL2

Method	KEL2/KEL2 (%)	KEL1/KEL2 (%)	KEL1/KEL1 (%)
Serology	187 (93.5)	13 (6.5)	0 (0)
Molecular	187 (93.5)	13 (6.5)	0 (0)

Fig. 1.

Agarose gel electrophoresis of multiplex SSP-PCR product of KEL1 and KEL2. From left to right lanes 2 and 3 are heterozygous and lanes 7 and 8 are homozygous for KEL2. Lane 5 is DNA size marker 100 bp ladder

Discussion

The Kell blood group system is important in transfusion medicine since it is the main cause of the hemolytic disease of the fetus and newborn (HDNF) and hemolytic reaction of transfusion. KEL1 and KEL2 are the most clinically important antigens of this system. KEL1 is highly immunogenic and can induce a strong antibody response in people lacking it [2]. Blood banks routinely do not type blood for Kell antigens. This may result in transfusing KEL1-negative patients with KEL1-positive blood. This is especially true about multi-transfused patients like thalassemic individuals or people suffering from anemia of chronic diseases [4, 5].

The frequency of KEL1 and KEL2 alleles in our population was determined to 6.5% and 93.5% respectively. These are somewhat consistent with those reported for white people (8.8% and 91% respectively) [8].

In this study, we analyzed 200 samples by serological and molecular methods in parallel for KEL1 and KEL2. There was no discrepancy between the two methods indicating that the molecular method can be used as an alternative to the serological method in instances where the patient sample is not a true representative of their RBCs. This is the case with multi-transfused individuals who are on regular transfusion.

We designed a multiplex PCR for the determination of KEL1 and KEL2 in a single reaction. This is very helpful for the genotyping of samples where the serological method is of limited value.

In conclusion, this multiplex assay can be used to determine KEL1/KEL2 genotype in a relatively short time. It is especially suitable for multi transfused patients like thalassemia in whom serological results are not conclusive.

Author’s Contribution

PZ performed the molecular tests. MP performed serological tests. KM designed the research. MS and FS wrote the manuscript.

Compliance with Ethical Standards

Conflict of interest

The authors declared no competing interest.