| Antibodies |
| IHC anti-tyrosine hydroxylase primary |
Immunostar |
22941 |
| IHC anti-RFP primary |
Rockland |
600-401-379 |
| IHC Alexa Fluor 488 goat anti-mouse secondary |
Thermo Fisher Scientific |
A-11001 |
| IHC Alexa Fluor 633 goat anti-mouse secondary |
Thermo Fisher Scientific |
A-21050 |
| IHC Alexa Fluor 546 goat anti-rabbit secondary |
Thermo Fisher Scientific |
A-11035 |
| WB anti-Histone-3 primary |
Cell Signaling |
96C10 |
| WB anti-VMAT2 primary |
Alomone Labs |
AMT-006 |
| WB anti-Dopamine Transporter primary |
Abcam |
128848 |
| WB goat anti-rabbit HRP secondary |
Bio-Rad |
170–5046 |
| WB goat anti-mouse HRP secondary |
Bio-Rad |
170–5047 |
| Bacterial and virus strains |
| AAV5-hSyn-Coff/Fon-EYFP-WPRE |
UNC vector core |
N/A |
| AAV8-hSyn-Con/Fon-hChR2(H134R)-EYFP |
Addgene |
55645-AAV8 |
| AAV-DJ-hSyn-Coff/Fon-eYFP-WPRE |
Stanford Gene Vector and Virus Core |
GVVC-AAV-082 |
| Chemicals, peptides, and recombinant proteins |
| isoflurane |
Piramal Healthcare |
PIR001710 |
| paraformaldehyde |
Electron Microscopy Sciences |
15710-S |
| sodium azide |
Sigma-Aldrich |
26628-22-8 |
| BlockAid blocking solution |
Life Technologies |
B10710 |
| Triton X-100 |
Sigma-Aldrich |
T8787 |
| Halt phosphatase buffer inhibitor |
Fisher Scientific |
PI78420 |
| Complete mini EDTA-free protease inhibitor |
Roche |
4693159001 |
| 4x Laemmli sample buffer |
Bio-Rad |
161–0747 |
| 2-mercaptoethanol |
Thermo Fisher Scientific |
21985023 |
| Critical commercial assays |
| In-Fusion HD cloning |
Takara |
639649 |
| BCA assay |
Fisher Scientific |
PI23227 |
| Experimental models: Cell lines |
| Ai65 mouse embryonic stem cells |
gift from Dr. Tanya Daigle |
Derived from JAX strain #021875 |
| Experimental models: Organisms/strains |
| DAT-P2A-Flpo mice |
Generated in this study, deposited with Jackson Laboratories (JAX) |
JAX stock #035436 |
| DAT-IRES-Cre mice |
Jackson Laboratory |
JAX stock #006660 |
| C57BL/6J mice |
Jackson Laboratory |
JAX stock #000664 |
| RCE-FRT mice |
Jackson Laboratory |
JAX stock #32038 |
| Ai65D mice |
Jackson Laboratory |
JAX stock #021875 |
| Nex-Cre mice |
gift from Dr. Klaus-Armin Nave; Goebbels et al., 2006
|
N/A |
| Oligonucleotides |
| CATGCAGAAGGACAGACACT |
Integrated DNA technologies |
current study; DAT-Flpo geno forward |
| AGGATGTCGAACTGGCTCAT |
Integrated DNA technologies |
current study; Flpo insert reverse |
| ACCCTGCGTGTGTGTAATAT |
Integrated DNA technologies |
current study; DAT-Flpo geno reverse |
| DAT-P2A-Flpo gBlock gene fragment |
Integrated DNA technologies |
current study; see STAR Methods for sequence |
| Recombinant DNA |
| pCRII-TOPO plasmid |
Invitrogen |
Part of kit #K461020 |
| pX330 Cas9 plasmid |
Addgene |
#42230 |
| Software and algorithms |
| ImageJ |
NIH |
N/A |
| GraphPad Prism |
GraphPad Software |
N/A |
| ANY-maze |
Stoelting Co |
N/A |
| TrailMap |
Friedmann et al., 2020 |
N/A |
