| Gene | Forward primer | Reverse primer |
|---|---|---|
| β‐actin | ctcttccagccttccttc | atctccttctgcatcctgtc |
| GLI2 | tggccgcttcagatgacagatgttg | cgttagccgaatgtcagccgtgaag |
| GLI3 | ggccatccacatggaatatc | tgaagagctgctacgggaat |
| PMIS‐miR‐200a | ctaaacatcgttaccaatcagacagtg | gtcagctcttagtattcatgagatg |
| PMIS‐miR‐200c | ctaatccatcattacccatcagacagtatta | gtcagctcttagtattcatgagatg |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.