Skip to main content
. 2021 Jul 1;10:e68203. doi: 10.7554/eLife.68203

Key resources table.

Reagent type
(species) or
resource
Designation Source or
reference
Identifiers Additional
information
Gene (Mus musculus) Pycard Ensemble ENSG00000103490
Strain, strain background (Mus musculus) AKR/J JAX 648
Strain, strain background (Mus musculus) DBA/2J JAX 671
Cell line (Mus musculus) DBA/2J mouse ES cell line AC173/GrsrJ JAX 000671C02
Cell line (Mus musculus) (Puromycin-resistant MEF feeder cells) Cell Biolabs CBA-312
Cell line (Mus musculus) Neomycin-resistant MEF feeder cells (Cell Biolabs, CBA-311) Cell Biolabs CBA-311
Transfected construct (S. pyogenes) Cas9 expression plasmid pSpCas9(BB)−2A-Puro Addgene PX459
Transfected construct (Aequorea Victoria) MSCV-miRE-shRNA IFT88-PGK-neo-IRES-GFP plasmid, Addgene 73576
Antibody Mouse monoclonal anti Cas9 (Diagenode, C15200203) Diagenode C15200203 IHC (1:1000)
Antibody Rabbit monoclonal anti-mouse AS Cell Signalling 67824 WB(1:500)
Antibody Rabbit polyclonal anti-ASC N-terminus Santa Cruz Biotech Sc-22514-R IF (10 μg/ml)
Antibody Goat polyclonal alexa Flour 568 anti-rabbit IgG ThermoFisher A-11011 IF (2 μg/ml)
Antibody Mouse monoclonalHRP-conjugated anti β-actin Santa Cruz Biotech Sc-47778-HRP (WB (1:20,000))
Sequence-based reagent qPCR for mouse Pycard ThermoFisher 4331182, Assay ID: Mm00445747_g1
Sequence-based reagent qPCR for mouse Actb ThermoFisher 4448484, Assay ID: Mm02619580_g1
Sequence-based reagent Nuclear run-on qPCR for mouse Pycard ThermoFisher 4441114, Assay ID: AJMSHN7
Sequence-based
reagent
sgRNA for GFP stop codon Synthego Custom GGGCGAGGGCGAUGCCACCU
Sequence-based reagent sgRNA for Pycard 3’ UTR Synthego Custom AGAUACCUCAGCUCUGCUCC
Peptide, recombinant protein Leukaemia inhibitory factor Millipore-Sigma ESG1107
Peptide, recombinant protein Mouse IL-3 R and D Systems 403 ML
Commercial assay or kit Mouse Il-1β ELISA R and D Systems MLB00C
Commercial assay or kit SuperScript VILO cDNA synthesis kit ThermoFisher 1175505
Commercial assay or kit iScript cDNA synthesis kit BioRad 1708891
Chemical compound, drug LPS from E. coli O55:B5 Sigma L6529
Chemical compound, drug ATP Sigma A2383
Software, algorithm Custom special R functions This paper https://github.com/BrianRitchey/qtl See Methods section
Software, algorithm r/QTL Reference 30 in this paper https://rqtl.org/download/
Other 30 µm sterile filters Sysmex 04-004-2326 To filter out embryonic bodies during ESDM differentiation