Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Mus musculus) | Pycard | Ensemble | ENSG00000103490 | |
| Strain, strain background (Mus musculus) | AKR/J | JAX | 648 | |
| Strain, strain background (Mus musculus) | DBA/2J | JAX | 671 | |
| Cell line (Mus musculus) | DBA/2J mouse ES cell line AC173/GrsrJ | JAX | 000671C02 | |
| Cell line (Mus musculus) | (Puromycin-resistant MEF feeder cells) | Cell Biolabs | CBA-312 | |
| Cell line (Mus musculus) | Neomycin-resistant MEF feeder cells (Cell Biolabs, CBA-311) | Cell Biolabs | CBA-311 | |
| Transfected construct (S. pyogenes) | Cas9 expression plasmid pSpCas9(BB)−2A-Puro | Addgene | PX459 | |
| Transfected construct (Aequorea Victoria) | MSCV-miRE-shRNA IFT88-PGK-neo-IRES-GFP plasmid, | Addgene | 73576 | |
| Antibody | Mouse monoclonal anti Cas9 (Diagenode, C15200203) | Diagenode | C15200203 | IHC (1:1000) |
| Antibody | Rabbit monoclonal anti-mouse AS | Cell Signalling | 67824 | WB(1:500) |
| Antibody | Rabbit polyclonal anti-ASC N-terminus | Santa Cruz Biotech | Sc-22514-R | IF (10 μg/ml) |
| Antibody | Goat polyclonal alexa Flour 568 anti-rabbit IgG | ThermoFisher | A-11011 | IF (2 μg/ml) |
| Antibody | Mouse monoclonalHRP-conjugated anti β-actin | Santa Cruz Biotech | Sc-47778-HRP | (WB (1:20,000)) |
| Sequence-based reagent | qPCR for mouse Pycard | ThermoFisher | 4331182, Assay ID: Mm00445747_g1 | |
| Sequence-based reagent | qPCR for mouse Actb | ThermoFisher | 4448484, Assay ID: Mm02619580_g1 | |
| Sequence-based reagent | Nuclear run-on qPCR for mouse Pycard | ThermoFisher | 4441114, Assay ID: AJMSHN7 | |
| Sequence-based reagent |
sgRNA for GFP stop codon | Synthego | Custom | GGGCGAGGGCGAUGCCACCU |
| Sequence-based reagent | sgRNA for Pycard 3’ UTR | Synthego | Custom | AGAUACCUCAGCUCUGCUCC |
| Peptide, recombinant protein | Leukaemia inhibitory factor | Millipore-Sigma | ESG1107 | |
| Peptide, recombinant protein | Mouse IL-3 | R and D Systems | 403 ML | |
| Commercial assay or kit | Mouse Il-1β ELISA | R and D Systems | MLB00C | |
| Commercial assay or kit | SuperScript VILO cDNA synthesis kit | ThermoFisher | 1175505 | |
| Commercial assay or kit | iScript cDNA synthesis kit | BioRad | 1708891 | |
| Chemical compound, drug | LPS from E. coli O55:B5 | Sigma | L6529 | |
| Chemical compound, drug | ATP | Sigma | A2383 | |
| Software, algorithm | Custom special R functions | This paper | https://github.com/BrianRitchey/qtl | See Methods section |
| Software, algorithm | r/QTL | Reference 30 in this paper | https://rqtl.org/download/ | |
| Other | 30 µm sterile filters | Sysmex | 04-004-2326 | To filter out embryonic bodies during ESDM differentiation |