Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Mus musculus) | Sp110 | GenBank | Gene ID: 109032 | |
| Gene (Mus musculus) | Sp140 | GenBank | Gene ID: 434484 | |
| Strain, strain background (M. tuberculosis, Erdman) | M. tuberculosis | Sarah Stanley, University of California, Berkeley | Erdman | |
| Strain, strain background (Legionella pneumophila, JR32 ΔflaA) | L. pneumophila | Dario Zamboni, University of São Paulo, Brazil | JR32 | |
| Genetic reagent (Mus musculus) | Sp110–/– | This paper | (C57BL/6J background) | |
| Genetic reagent (Mus musculus) | Sp140–/– | This paper | (C57BL/6J background) | |
| Genetic reagent (Mus musculus) | B6.129S2-Ifnar1tm1Agt/Mmjax | Jackson Laboratory | RRID:MMRRC_032045-JAX | |
| Genetic reagent (Mus musculus) | B6J.C3-Sst C3HeB/FeJKrmn | Igor Kramnik, Boston University | ||
| Cell line (Homo sapiens) | GP-2 293 | UC Berkeley Cell culture Facility | RRID:CVCL_WI48 | |
| Antibody | Rabbit polyclonal anti-mouse SP110 (serum) | Covance, this paper | WB (1:1000) | |
| Antibody | Rabbit polyclonal anti-mouse SP140 (serum) | Covance, this paper | WB (1:1000) | |
| Antibody | Mouse monoclonal anti-mouse SP110 (hybridoma) | Igor Kramnik, Boston University | WB (1:1000) | |
| Antibody | Mouse anti-human IFNGR-α chain (isotype control) | Leinco Technologies, Inc | Cat #: GIR208 | Mouse injection (500 μg) |
| Antibody | Mouse anti-mouse IFNAR1 | Leinco Technologies, Inc | Cat #: MAR1-5A3 | Mouse injection (500 μg) |
| Recombinant DNA reagent | SINV-mincmvSp140-pgkAmetrine (plasmid) | This paper | Derived from pTMGP vector (Addgene plasmid # 32716, RRID:Addgene_32716) | |
| Recombinant DNA reagent | SINV-Gal4-mincmv-mNeonGreen-pgkAmetrine (plasmid) | This paper | Derived from pTMGP vector (Addgene plasmid # 32716, RRID:Addgene_32716) | |
| Recombinant DNA reagent | pMD2.G | Addgene | RRID:Addgene_12259
plasmid #32716 |
|
| Peptide, recombinant protein | Recombinant murine TNF alpha | R&D Systems | Cat #: 410-TRNC-010 | BMM stimulation (10 ng/mL) |
| Peptide, recombinant protein | Recombinant murine interferon gamma | Biolegend | Cat #: 575304 | BMM stimulation (5–10 ng/mL) |
| Peptide, recombinant protein | Retronectin | Takara | T100 | |
| Sequence-based reagent | Sp110 fwd | This paper | Genotyping primers (Sp110) | CTCTCCGCTCGGTGACTAC |
| Sequence-based reagent | Sp110 rev | This paper | Genotyping primers (Sp110) | CTGCACATGTGACAAGGATCTC |
| Sequence-based reagent | Sp140-1 fwd | This paper | Genotyping primers (Sp140) | ACGAATAGCAAGCAGGAATGCT |
| Sequence-based reagent | Sp140-1 rev | This paper | Genotyping primers (Sp140) | GGTTCCGGCTGAGCACTTAT |
| Sequence-based reagent | Sp140-2 fwd | This paper | Genotyping primers (Sp140) | TGAGGACAGAACTCAGGGAG |
| Sequence-based reagent | Sp140-2 rev | This paper | Genotyping primers (Sp140) | ACACGCCTTTAATCCCAGCATTT |
| Sequence-based reagent | Ifnb sense | This paper | RT-qPCR primers (Ifnb) | GTCCTCAACTGCTCTCCACT |
| Sequence-based reagent | Ifnb antisense | This paper | RT-qPCR primers (Ifnb) | CCTGCAACCACCACTCATTC |
| Commercial assay or kit | E.Z.N.A. Total RNA Kit I | Omega Biotek | Cat #: R6834-02 | |
| Chemical compound, drug | polyI:C | Invivogen | Cat #: tlrl-picw | BMM stimulation (100 μg/mL) |