Skip to main content
. 2021 Mar 11;41(5):1044–1057. doi: 10.1111/liv.14831

TABLE 2.

Complete list of 36 candidate risk genes for early‐onset PSC from 22 patient‐parent trios

Trio Chr: position:alleles rs number Candidate risk gene Inheritance mode (parental allele) GnomAD allele count Population frequency Amino Acid change CADD‐score Literature category Protein function
3 2:220075521:C/T rs148211042 ABCB6 Compound heterozygous (mother) 217 = 0.00077 p.R723Q 35.0 1 Binds heme and porphyrins and functions in their ATP‐dependent uptake into the mitochondria. 20 , 21 Mutations in this gene underlie familial pseudohyperkalemia (OMIM 609 153) and dyschromatosis universalis hereditarian (OMIM 615 402).
2:220078006:C/T rs145526996 ABCB6 Compound heterozygous (father) 1236 = 0.0043 p.G588S 32.0
4 8:39044452:G/A rs745952927 ADAM32 Compound heterozygous (father) 30 = 0 p.A314T 12.93 1 This gene encodes a member of the disintegrin family of membrane‐anchored proteins that play a role in diverse biological processes such as brain development, fertilization, tumour development and inflammation. 28
8:39103683:A/G rs150114293 ADAM32 Compound heterozygous (mother) 192 = 0.001 p.G634R 29.8
4:164775272:C/T Unknown MARCH1 De novo Unobserved p.W4* 38.0 1 Downregulates surface expression of major histocompatibility complex (MHC) class II molecules and other glycoproteins by directing them to the late endosomal/lysosomal compartment. 18 , 19
16:1537911:C/T rs775407157 PTX4 De novo 3 = 0.000012 p.V63 M 12.5 1 Pentraxins are part of the humoral arm of innate immunity and behave as functional ancestors of antibodies by mediating agglutination, complement activation and opsonization. PTX4 is a new unique member of the pentraxin superfamily, conserved in evolution. Further studies are needed to define its function. 29
17:37234300:G/A Unknown PLXDC1 De novo Unobserved p.A351V 23.8 2 Plays a critical role in endothelial cell capillary morphogenesis. 30
6 16:67911677:G/A rs111231628 EDC4 Compound heterozygous (mother) 447 = 0.002 p.S275G 10.93 1 Enhancer Of MRNA Decapping. 31 Diseases associated with EDC4 include Human Granulocytic Anaplasmosis and Anteroseptal Myocardial Infarction.
16:67916920:C/T rs563149577 EDC4 Compound heterozygous (father) 21 = 0 p.A1230V 27.7
7 1:33794634:G/C rs376869490 PHC2 Compound heterozygous (father) 41 = 0 p.I753 M 23.2 2 Component of a Polycomb group (PcG) multiprotein PRC1‐like complex, a complex class required to maintain the transcriptionally repressive state of many genes, including Hox genes, throughout development. 32

1:33820146:T/C

 rs142759750 PHC2 Compound heterozygous (mother) 40 = 0 p.D471N 18.51
7:5427971:C/A Unknown TNRC18 De novo 0 p.G495V 14.88 2

Protein Coding gene. Diseases associated with TNRC18 include Atrial Septal Defect and Seckel Syndrome. 33 Lead CpGs at TNRC18 map to active enhancers in kidney cortex and are associated with renal fibrosis.. 34

9 9:133047587:C/G Unknown HMCN2 Compound heterozygous (father) 8 = 0 p.Q161E 22.8 2

Protein Coding gene. Diseases associated with HMCN2 include Posterior Myocardial Infarction. 35

9:133305895:A/G rs559374161 HMCN2 Compound heterozygous (mother) 63 = 0 p.G4293E 3.171
10 8:134225273:G/A Unknown CCN4 De novo Unobserved p.C79Y 27.2 3 Mediates diverse developmental processes, such as control of cell proliferation, adhesion, cell polarity and establishment of cell fates. 36
12 2:84816032:T/A Unknown DNAH6 De novo Unobserved p.L855H 22.8 3 Force generating protein of respiratory cilia. Produces force towards the minus ends of microtubules. Diseases associated include Primary Ciliary Dyskinesia and Anomalous Left Coronary Artery From The Pulmonary Artery. 37 :
11:64645648:G/A rs747258453 EHD1 Compound heterozygous (mother) Unobserved

p.F97L

 27.8 1 Important motif in proteins involved in protein‐protein interactions and in intracellular sorting. The protein encoded by this gene is thought to play a role in the endocytosis of IGF1 receptors. 38
11:64645841:C/T Unknown EHD1 Compound heterozygous (father) 2 = 0 p.= 15.68
6:129621952:A/T Unknown LAMA2 Compound heterozygous (father) Unobserved p.I1037F 18.85 3 It is thought to mediate the attachment, migration and organization of cells into tissues during embryonic development by interacting with other extracellular matrix components. Diseases associated with LAMA2 include Muscular Dystrophy. 39
6:129824345:T/C rs151334775 LAMA2 Compound heterozygous (mother) 22 = 0 p.P2823S 25.3
13 2:196720589:C/A rs749776504 DNAH7 Compound heterozygous (father) 6 = 0 p.R2847S 12.06 3 Force generating protein of respiratory cilia. Produces force towards the minus ends of microtubules. 40 Diseases associated with DNAH7 include Situs Inversus and Dextrocardia With Situs Inversus.
2:196889160:A/G rs182086316 DNAH7 Compound heterozygous (mother) 439 = 0.002 p.R246C 29.2
14 11:1606144: ACAAGAGCCACAGCCCCCCTTGG/. rs761147271 KRTAP5‐1 De novo Unobserved p.S105Wfs*115 ‐ 3 In the hair cortex, hair keratin intermediate filaments are embedded in an interfilamentous matrix, consisting of hair keratin‐associated protein (KRTAP), which are essential for the formation of a rigid and resistant hair shaft through their extensive disulphide bond cross‐linking with abundant cysteine residues of hair keratins. 41 :
20:5935281:A/G rs377435486 MCM8 De novo 14 = 0 p.E94G 23.1 3 The protein encoded by this gene is one of the highly conserved mini‐chromosome maintenance proteins (MCM) that are essential for the initiation of eukaryotic genome replication. Diseases associated with MCM8 include Premature Ovarian Failure 10 and Amenorrhea. 42
15 17:73499287:T/C rs200947487 CASKIN2 Compound heterozygous (mother) 150 = 0.001 p.R623Q 18.14 2 This gene encodes a large protein that contains six ankyrin repeats, as well as a Src homology 3 (SH3) domain and two sterile alpha motif (SAM) domains, which may be involved in protein‐protein interactions. 43
17:73500515:G/A rs201521912 CASKIN2 Compound heterozygous (father) 83 = 0 p.P454L 17.33
16 1:203018043:G/C rs61756414 PPFIA4 Compound heterozygous (mother) 43 = 0 ‐ 15.66 2 May regulate the disassembly of focal adhesions. May localize receptor‐like tyrosine phosphatases type 2A at specific sites on the plasma membrane, possibly regulating their interaction with the extracellular environment and their association with substrates. 44
1:203036894:G/T rs528573275 PPFIA4 Compound heterozygous (father) 9 = 0 p.R1041L 33
17 5:176002840:G/A rs780769740 CDHR2 De novo 5 = 0.00003 p.=SPLICE_SITE DONOR 16.9 1 Intermicrovillar adhesion molecule that controls the packing of microvilli at the apical membrane of epithelial cells. 23 , 24
12:12974228:C/T rs780873695 DDX47 De novo 2 = 0 p.P90S 24.5 1 Involved in apoptosis. May have a role in rRNA processing and mRNA splicing. Associates with pre‐rRNA precursors. 45 :
18 2:188228104:G/A Unknown CALCRL De novo Unobserved p.P209L 29.6 2 Receptor for calcitonin gene‐related peptide (CGRP) and adrenomedullin. 46
8:11996026:T/G rs201734663 USP17L2 Compound heterozygous (mother) 51 = 0 p.L82I ‐ 1 Has deubiquitinating activity. Also regulates cell proliferation and apoptosis through deubiquitination of SUDS3 a regulator of histone deacetylation. 47
8:11996122:C/T rs199985479 USP17L2 Compound heterozygous (father) 76 = 0 p.D50N 0.034
19 2:97790321:A/G rs770051110 ANKRD36 Compound heterozygous (mother) 16 = 0 p.A240T 11.81 2 Protein Coding gene. Diseases associated with ANKRD36 include Giant Axonal Neuropathy. 48 :
2:97823866:C/T rs567234399 ANKRD36 Compound heterozygous (father) 12 = 0 p.T428 M 18.47
7:21805095:A/G rs35865357 DNAH11 Compound heterozygous (mother) 3087 = 0.011 p.R2997Q 35 3 Force generating protein of respiratory cilia. Produces force towards the minus ends of microtubules. 49 Diseases associated with DNAH11 include Ciliary Dyskinesia, Primary and Primary Ciliary Dyskinesia.
7:21901605:G/C rs751035617 DNAH11 Compound heterozygous (father) Unobserved p.K3779N 19.07
1:145273295:C/T rs782819394 NOTCH2NLA De novo 4 = 0 p.T50 M 24.1 1 Human‐specific protein that promotes neural progenitor proliferation and evolutionary expansion of the brain neocortex by regulating the Notch signalling pathway via direct interaction with NOTCH2. 50 NOTCH2 variants are associated with Alagille syndrome, including cholestasis phenotypes (www.omim.org/entry/600275).
21 10:64927837:C/T rs71508957 JMJD1C Compound heterozygous (father) 1162 = 0.0041 p.E2531K 26.5 3 A candidate histone demethylase thought to be a co‐activator for key transcription factors. Plays a role in the DNA‐damage response pathway. 51
10:64974807:C/G rs200016210 JMJD1C Compound heterozygous (mother) 132 = 0.00047 p.D374H 26.2
14:59104943:C/T Unknown DACT1 Compound heterozygous (mother) 5 = 0 p.T8 M 23.6 3

Interacts with, and positively regulates, dishevelled‐mediated signalling pathways during development. 52

Associated with Townes‐Brocks syndrome‐2 (OMIM 617 466).
14:59113376:T/C rs200977826 DACT1 Compound heterozygous (father) 166 = 0.001 p.W679R 25.5
22 8:98289238:T/C rs151015596 TSPYL5 Compound heterozygous (father) 1053 = 0.004 p.S279G 17.38 3 Involved in modulation of cell growth and cellular response to gamma radiation probably via regulation of the Akt signalling pathway. Involved in regulation of p53/TP53. 53 :
8:98290012:A/C rs79679520 TSPYL5 Compound heterozygous (mother) 485 = 0.003 p.A21S 23.3
23 4:103832611:G/A rs75599926 SLC9B1 De novo 2 = 0.000011 p.R305* 36. 1 Sodium/hydrogen exchanger and transmembrane protein. 54
24 6:123786033:./A rs201431159 TRDN De novo Unobserved p.S297Ffs*32 n.a. 2 Contributes to regulation of luminal Ca2 + release via the sarcoplasmic reticulum calcium release channels. 55 Associated with ventricular tachycardia (OMIM 615 441)
25 12:13219604:T/C rs367547952 FAM234B Compound heterozygous (mother) 23 = 0 p.R295W 35 2 Protein Coding gene. Diseases associated with FAM234B include Temtamy Syndrome and Autosomal Dominant Non‐Syndromic Intellectual Disability. 56 :
12:13221607:T/A rs140271825 FAM234B Compound heterozygous (father) 150 = 0.001 p.F444I 25.6
26 18:2722603:G/A Unknown SMCHD1 De novo Unobserved p.D849N 31 3 Involved in DNA management and plays an essential role in X chromosome inactivation. 57
11:126162948:G/A rs185114125 TIRAP De novo 49 = 0 p.R215H 23.6 1 Adapter involved in TLR2 and TLR4 signalling pathways in the innate immune response. Acts via IRAK2 and TRAF‐6, leading to the activation of NF‐kappa‐B, MAPK1, MAPK3 and JNK, and resulting in cytokine secretion and the inflammatory response. 58
28 12:105151159:G/A Unknown CHST11 De novo Unobserved p.G213S 32. 3 Catalyses the transfer of sulphate in chondroitin. 59 Diseases associated with CHST11 include Mucinoses and Costello Syndrome (OMIM 618 167).
29 X:69623814:A/G Unknown KIF4A De novo Unobserved p.N907S 10.11 3 Iron‐sulphur (Fe‐S) cluster binding motor protein that has a role in chromosome segregation during mitosis. 60
19:35434411:C/T rs367651957 ZNF30 Compound heterozygous (mother) 43 = 0 p.C182R 23.2 2 May be involved in transcriptional regulation. 61 Diseases associated with ZNF30 include Chromosome 19Q13.11 Deletion Syndrome and Brugada Syndrome.
19:35435632:C/T rs140215760 ZNF30 Compound heterozygous (father) 542 = 0.002 p.R589W 25.8

Abbreviations: CADD‐score, Combined Annotation‐Dependent Depletion scoreChr, Chromosome.