Skip to main content
. Author manuscript; available in PMC: 2022 Jul 1.
Published in final edited form as: Mol Cell. 2021 May 7;81(13):2693–2704.e12. doi: 10.1016/j.molcel.2021.04.013

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
Rabbit polyclonal anti-WNK1 Bethyl Cat# A301-515A, RRID:AB_999680
Rabbit polyclonal anti-EMC2 Proteintech Cat# 25443-1-AP, RRID:AB_2750836
Mouse monoclonal anti-EMC3 Proteintech Cat# 67205-1-Ig, RRID:AB_2882498
Rabbit polyclonal anti-EMC4 Proteintech Cat# 27708-1-AP, RRID:AB_2880950
Rabbit polyclonal anti-EMC5 Bethyl Cat# A305-833A-M, RRID:AB_2890207
Rabbit polyclonal anti-EMC6 Abcam Cat# ab84902, RRID:AB_1925516
Rabbit polyclonal anti-EMC8 Proteintech Cat# 19889-1-AP, RRID:AB_2878618
Rabbit polyclonal anti-FDFT1 Bethyl Cat# A305-361A, RRID:AB_2631752
Rabbit polyclonal anti-VAMP2 Cell Signaling Technology Cat# 13508, RRID:AB_2798240
Rabbit polyclonal anti-Hsp70 Enzo Life Sciences Cat# ADI-SPA-812, RRID:AB_10013742
Rabbit polyclonal anti-Ube2O Bethyl Cat# A301-873-A-T, RRID:AB_2780177
Mouse monoclonal anti-Bip BD Biosciences Cat# 610978, RRID:AB_398291
Rabbit polyclonal anti-AE2 Bethyl Cat# A304-502A, RRID:AB_2620696
Rabbit monoclonal anti-NKCC1 Cell Signaling Technology Cat# 8351, RRID:AB_10830068
Rabbit polyclonal anti-CLINT1 Bethyl Cat# A301-926A, RRID:AB_1524117
Rabbit polyclonal anti-γ-AP1 Bethyl Cat# A304-771A, RRID:AB_2620966
Mouse monoclonal anti-FLAG M2 Sigma-Aldrich Cat# F1804, RRID:AB_262044
Rabbit polyclonal anti-Clathrin Heavy Chain Bethyl Cat# A304-743A, RRID:AB_2620938
Rabbit monoclonal anti-Rps24 Abcam Cat# ab196652, RRID:AB_2714188
Mouse monoclonal anti-α-Tubulin Sigma-Aldrich Cat# T9026, RRID:AB_477593
Rabbit monoclonal anti-β-Actin Cell Signaling Technology Cat# 8457, RRID:AB_10950489
Rabbit polyclonal anti-MKRN1 Bethyl Cat# A300-990A
RRID:AB_2142814
Rabbit polyclonal anti-HUWE1 Proteintech Cat# 19430-1-AP, RRID:AB_2878579
Sheep polyclonal anti-SPAK/OSR1 MRC PPU Reagents and Services Cat# S637B, RRID:AB_2890208
Sheep polyclonal anti-SPAK/OSR1 pSer373/pSer325 Sigma-Aldrich Cat# 07-2273, RRID:AB_11205577
Rabbit polyclonal anti-GFP Gift from Ramanujan Hegde (Chakrabarti and Hegde, 2009) N/A
Rabbit polyclonal anti-TRAPα Gift from Ramanujan Hegde N/A
Rabbit polyclonal anti-BAG6 Gift from Ramanujan Hegde (Mariappan et al., 2010) N/A
Rabbit polyclonal anti-Sec61β Gift from Ramanujan Hegde N/A
HRP-conjugated mouse monoclonal anti-HA Sigma-Aldrich Cat# H6533, RRID:AB_439705
HRP-conjugated mouse monoclonal anti-FLAG M2 Sigma-Aldrich Cat# A8592, RRID:AB_439702
HRP-conjugated goat anti-rabbit IgG BioRad Cat# 170-6515, RRID:AB_11125142
HRP-conjugated goat anti-mouse IgG BioRad Cat# 172-1011, RRID:AB_11125936
Donkey polyclonal anti-mouse IgG Alexa Fluor 488 Thermo Scientific Cat# A-21202, RRID:AB_141607
Donkey polyclonal anti-rabbit IgG Alexa Fluor 647 Thermo Scientific Cat# A-31573, RRID:AB_2536183
Chemicals, peptides, and recombinant proteins
Doxycycline Sigma-Aldrich Cat# D9891, CAS: 24390-14-5
Digitonin Millipore Cat# 300410, CAS: 11024-24-1
LMNG Anatrace Cat# NG310, CAS: 1257852-96-2
Complete EDTA-free protease inhibitor cocktail Roche Cat# 11873580001
Pierce Streptavidin Magnetic Beads Thermo Scientific Cat# 88817
Anti-Flag M2 affinity resin Sigma-Aldrich Cat# A2220
3xFlag peptide Sigma-Aldrich Cat# F4799
Anti-HA agarose Sigma-Aldrich Cat# A2095
HA peptide Thermo Scientific Cat# 26184
Ni-NTA agarose QIAGEN Cat# 30210
Glutathione sepharose 4B GE Healthcare Cat# 17-0756-05
L-Glutathione, reduced Sigma-Aldrich Cat# G4251
Biotin Sigma-Aldrich Cat# B4501
PMSF Thermo Scientific Cat# 36978
EasyTag L-[35S]-Methionine Perkin Elmer Cat# NEG709A005MC
ATP, [γ-32P] Perkin Elmer Cat# BLU002A100UC
PEI MAX Mw 40,000 Polysciences Cat# 24765-1, CAS: 49553-93-7
Poly-D-lysine GIBCO Cat# A3890401
Amino acid kit Sigma-Aldrich Cat# 09416
PhosSTOP Phosphatase inhibitor tablets Roche Cat# 4906845001
Puromycin Dihydrochloride Thermo Scientific Cat# A1113803
Hygromycin B Millipore Cat# 400051-100KU, CAS: 31282-04-9
Blasticidin S Thermo Scientific Cat# A1113903, CAS: 3513-03-9
MG132 Proteasomal Inhibitor Calbiochem Cat# 474790
Bortezomib Calbiochem Cat# 504314, CAS 179324-69-7
PR619 Sigma-Aldrich Cat# SML0430
WNK463 MedChemExpress Cat# HY-100626, CAS 2012607-27-9
4-Benzoylphenylalanine (Bpa) Bachem Cat# 4017646.0001, CAS 104504-45-2
DAPI Sigma-Aldrich Cat# MBD0015
SlowFade Gold Thermo Scientific Cat# S36936
Sytox Blue Dead Cell Stain Thermo Scientific Cat# 34857
Creatine phosphate Roche Cat# 621714
Creatine kinase Roche Cat# 127566
His-Ubiquitin Boston Biochem Cat# U-530
UbcH5a Boston Biochem Cat# E2-616
GST-UBE1 (human) Boston Biochem Cat# E-306
S7 Micrococcal Nuclease Roche Cat# 10107921001
RNasin Promega Cat# N251
SP6 Polymerase New England Biolabs Cat# M0207L
DNAse I New England Biolabs Cat# M0303L
3xFLAG-Calmodulin Shao et al., 2017 N/A
Bpa-RS Shao et al., 2017 N/A
Amber suppressor tRNA Shao et al., 2017 N/A
Deposited data
CryoEM structure of the human EMC Pleiner et al., 2020 PDB 6WW7
CryoEM structure of the yeast EMC Bai et al., 2020 PDB 6WB9
Experimental models: cell lines
Flp-In T-REx 293 Thermo Scientific Cat# R78007, RRID: CVCL_U421
HeLa ATCC Cat# CCL-2, RRID:CVCL_0030
HeLa EMC2-GFP knock-in This paper N/A
HeLa Flp-In T-REx Gift from Christian Schlieker N/A
Expi 293F Thermo Scientific Cat# A14527, RRID:CVCL_D615
Flp-In T-REx 293 dox inducible GFP-2A-mCherry This paper N/A
Flp-In T-REx 293 dox inducible GFP-EMC2-2A-mCherry Pleiner et al., 2020 N/A
Flp-In T-REx 293 dox inducible EMC4-GFP-2A-mCherry This paper N/A
Flp-In T-REx 293 dox inducible EMC5-GFP-2A-mCherry This paper N/A
Flp-In T-REx 293 dox inducible GFP-NKCC1-2A-mCherry This paper N/A
Flp-In T-REx 293 dox inducible EMC5-3xFLAG This paper N/A
Flp-In T-REx 293 dox inducible GFP-WNK1 This paper N/A
Flp-In T-REx 293 dox inducible 3xFLAG-WNK1 This paper N/A
Flp-In T-REx 293 dox inducible 3xFLAG-WNK1 (L2250K, L2253K, W2257K) This paper N/A
HeLa Flp-In dox inducible GFP-2A-mCherry-FDFT1(SQS)(378-410)-Opsin This paper N/A
HeLa Flp-In dox inducible GFP-2A-mCherry-VAMP2(91-114)-Opsin This paper N/A
HeLa Flp-In dox inducible TRAM2-GFP-2A-mCherry This paper N/A
HeLa Flp-In dox inducible OPRK1-GFP-2A-mCherry This paper N/A
E. coli Rosetta™ 2(DE3) Novagen Cat# 71400
BL21 Competent E. coli New England Biolabs Cat# C2530H
NEBExpress® Iq Competent E. coli New England Biolabs Cat# C3037I
Oligonucleotides
On-Targetplus siRNA against WNK1: GCAGUUGUCUCAAUAUCUA Dharmacon Cat# J-005362-05-0002
On-Targetplus siRNA against WNK1: GCAGGAGUGUCUAGUUAUA Dharmacon Cat# J-005362-06-0002
On-Targetplus Non-targeting control siRNA #1: UGGUUUACAUGUCGACUAA Dharmacon Cat# D-001810-01-05
Silencer Select siRNA against WNK1: CAUCAUCCCUUAGUCUACAtt Thermo Scientific Cat# s35233
Silencer Select siRNA against WNK1: CCAGCGUAGUUUCAAGUAUtt Thermo Scientific Cat# s35234
Silencer Select siRNA against WNK1: CAAUGAGUCAGAUAUCGAAtt Thermo Scientific Cat# s35235
Silencer Select siRNA against EMC2: CAAUGAACAUGACUAUGCAtt Thermo Scientific Cat# s18670
Silencer Select siRNA against EMC5: GGCCUUUGCAGUUACCUGUtt Thermo Scientific Cat# s41131
Silencer Select negative control no. 2 siRNA Thermo Scientific Cat# 4390846
sgRNA against EMC2 C-terminus for knock-in: TTGCAGATCACCCAGTCTTA This paper N/A
Recombinant DNA
pcDNA3.1 HA CFP hsNKCC1 WT – source of NKCC1 coding sequence Gift from Biff Forbush (Somasekharan et al., 2013) Addgene ID #49077
pCRISPaint-TagBFP – source of TagBFP coding sequence Gift from Veit Hornung (Schmid-Burgk et al., 2016) Addgene ID #67168
pSpCas9(BB)-2A-Puro (pX459) Gift from Feng Zhang (Ran et al., 2013) Addgene ID #48139
pTP602_gRNA against human EMC2 C-terminus used for knock-in in pX459 This paper N/A
pTP600_EMC2-GFP knock-in donor plasmid This paper N/A
MISSION® pLKO.1-puro Non-Mammalian shRNA Control Plasmid Sigma-Aldrich Cat# SHC002
TRC1.5_pLKO-puro Mission shRNA targeting WNK1 Sigma-Aldrich Cat# TRCN0000000919
pCMV6-Entry-WNK1-Myc-1xFLAG (human) ORF clone Origene Cat# RC218208
pTP061_pCMV6-Entry-WNK1(1-2106)-Myc-1xFLAG (human) This paper N/A
pTP062_pCMV6-Entry-WNK1(1-2200)-Myc-1xFLAG (human) This paper N/A
pTP063_pCMV6-Entry-WNK1(1-2272)-Myc-1xFLAG (human) This paper N/A
pcDNA5/FRT/TO Thermo Scientific Cat# V652020
Flp-Recombinase pOG44 Thermo Scientific Cat# V600520
pTP045_GFP-2A-mCherry in pcDNA5/FRT/TO This paper N/A
pTP021_GFP-EMC2-2A-mCherry in pcDNA5/FRT/TO Pleiner et al., 2020 N/A
pTP244_EMC4-GFP-2A-mCherry in pcDNA5/FRT/TO This paper N/A
pTP022_EMC5-GFP-2A-mCherry in pcDNA5/FRT/TO This paper N/A
pTP092_GFP-NKCC1-2A-mCherry in pcDNA5/FRT/TO This paper N/A
pTP004_EMC5-3xFLAG in pcDNA5/FRT/TO This paper N/A
pTP428_GFP-WNK1 in pcDNA5/FRT/TO This paper N/A
pTP047_3xFLAG-WNK1 in pcDNA5/FRT/TO This paper N/A
pTP115_3xFLAG-WNK1 (L2250K, L2253K, W2257K) in pcDNA5/FRT/TO This paper N/A
pTP064_GFP-2A-mCherry-FDFT1(SQS)(378-410)-Opsin in pcDNA5/FRT/TO This paper N/A
pTP040_GFP-2A-mCherry-VAMP2(91-114)-Opsin in pcDNA5/FRT/TO This paper N/A
pTP131_TRAM2-GFP-2A-mCherry in pcDNA5/FRT/TO This paper N/A
pTP498_OPRK1-GFP-2A-mCherry in pcDNA5/FRT/TO This paper N/A
pTP604_3xHA-Ubiquitin in pcDNA5/FRT/TO This paper N/A
pcDNA3.1 Thermo Scientific Cat# V79020
pTP123_3xFLAG-TagBFP-WNK1 in pcDNA3.1 This paper N/A
pTP118_3xFLAG-TagBFP-WNK1(2241-2266) in pcDNA3.1 This paper N/A
pTP182_3xFLAG-TagBFP-WNK1(2241-2266) (L2250K, L2253K, W2257K) in pcDNA3.1 This paper N/A
pRMV409_3xFLAG-TagBFP in pcDNA3.1 This paper N/A
pHAGE2 lentiviral transfer vector Gift from Magnus A. Hoffmann and Pamela Bjorkman N/A
pΔ8.9 and pVSV-G packaging plasmids Gift from Carlos Lois N/A
pTP340_3xFLAG-TagBFP-EMC2 (human) in pHAGE2 This paper N/A
pTP377_3xFLAG-TagBFP-EMC2 (E156A) (human) in pHAGE2 This paper N/A
pTP461_3xFLAG-TagBFP-EMC2 (E180A) (human) in pHAGE2 This paper N/A
pTP355_EMC5-TagBFP-3xFLAG (human) in pHAGE2 This paper N/A
pTP357_EMC5(F90A)-TagBFP-3xFLAG (human) in pHAGE2 This paper N/A
pTP360_EMC5(F93A)-TagBFP-3xFLAG (human) in pHAGE2 This paper N/A
SP64 vector Promega Cat# P1241
pRMV188_3xFLAG-hsSec61b(2-13)-ggVillin-1(792-826)-hsSec61beta(13-68) in SP64 Shao et al., 2013 N/A
RMV225_3xFLAG-hsSec61beta(2-end) in SP64 This paper N/A
pTP007_3xHA-EMC2 (human) in SP64 This paper N/A
pTP345_3xHA-EMC2 (Y171A) (human) in SP64 This paper N/A
pTP369_3xHA-EMC2 (Y200A) (human) in SP64 This paper N/A
pTP332_3xHA-EMC2 (R227A) (human) in SP64 This paper N/A
pTP370_3xHA-EMC2 (R28A) (human) in SP64 This paper N/A
pTP342_3xHA-EMC2 (E156A) (human) in SP64 This paper N/A
pTP343_3xHA-EMC2 (E160A) (human) in SP64 This paper N/A
pTP367_3xHA-EMC2 (E180A) (human) in SP64 This paper N/A
pTP368_3xHA-EMC2 (W259A) (human) in SP64 This paper N/A
pTP008_3xHA-EMC8 (human) in SP64 This paper N/A
pTP361_hsEMC5-3xFLAG (human) in SP64 This paper N/A
pTP363_hsEMC5(F90A)-3xFLAG (human) in SP64 This paper N/A
pTP366_hsEMC5(F93A)-3xFLAG (human) in SP64 This paper N/A
gb001_SP6 3xFLAG-EMC2 (human) gblock This paper N/A
gb033_SP6 EMC3-3xFLAG (human) gblock This paper N/A
gb076_SP6 3xHA-EMC2 (yeast) gblock This paper N/A
gb077_SP6 EMC5-3xFLAG (yeast) gblock This paper N/A
gb078_SP6 EMC3-3xFLAG (yeast) gblock This paper N/A
T7 PURExpress plasmid New England Biolabs Cat# E6800S
pRMV210_T7 3xHA-Sec61β(2-end)(F85Amber) human in T7 PURExpress This paper N/A
pTP112_T7 3xFLAG-Sec61β(2-59)-SQS(378-410)(Y400Amber)-Opsin in T7 PURExpress This paper N/A
All E. coli expression constructs in pQE80-derivative Qiagen N/A
pTP105_His14-bdNEDD8-EMC2 (human) This paper N/A
pTP030_His14-bdNEDD8-3xFLAG-EMC2 (human) This paper N/A
pTP024_His14-bdNEDD8-EMC8 (human) This paper N/A
pTP031_His14-bdNEDD8-3xFLAG-EMC8 (human) This paper N/A
pTP083_His14-bdSUMO-EMC3(35-117)-3xFLAG (human) This paper N/A
pTP128_His14-bdSUMO-EMC3(196-261)-3xFLAG (human) This paper N/A
pTP354_His14-bdSUMO-EMC5(66-131)-3xFLAG (human) This paper N/A
pTP189_His14-bdSUMO-OSR1(2-end)(D164A) (human) This paper N/A
pTP396_His14-Avi-Spacer-SUMOEu1-anti-GFP nanobody 3K1K Pleiner et al., 2015; Pleiner et al., 2020 Addgene ID #149336
pTP264_His14-bdNEDD8-BirA (E. coli) Gift from Dirk Görlich (Pleiner et al., 2015) Addgene ID #149334
pAV286_His14-Tev-SENPEuB Gift from Dirk Görlich (Pleiner et al., 2020; Vera Rodriguez et al., 2019) Addgene ID #149333
pDG02583_His14-MBP-bdSUMO-bdNEPD1 Gift from Dirk Görlich (Pleiner et al., 2018) Addgene ID #104129
pSF1389_His14-Tev-bdSENP1 Gift from Dirk Görlich (Frey and Görlich, 2014) Addgene ID #104962
pTP072_His14-bdSUMO-WNK1(2241-2266)-3xFLAG (human) This paper N/A
pTP096_His14-bdSUMO-WNK1(2241-2266)-3xHA (human) This paper N/A
pTP076_His14-bdSUMO-WNK1(2241-2266) (human) This paper N/A
pTP107_His14-bdSUMO-WNK1(2241-2266) L2250K) (human) This paper N/A
pTP108_His14-bdSUMO-WNK1(2241-2266) L2253K (human) This paper N/A
pTP109_His14-bdSUMO-WNK1(2241-2266) W2257K (human) This paper N/A
pTP322_His14-bdSUMO-WNK1(2241-2266) F2246K (human) This paper N/A
pTP323_His14-bdSUMO-WNK1(2241-2266) D2248K (human) This paper N/A
pTP324_His14-bdSUMO-WNK1(2241-2266) H2251K (human) This paper N/A
pTP325_His14-bdSUMO-WNK1(2241-2266) W2257L (human) This paper N/A
pTP326_His14-bdSUMO-WNK1(2241-2266) W2257A (human) This paper N/A
pTP327_His14-bdSUMO-WNK1(2241-2266) L2264K (human) This paper N/A
pTP463_His14-bdSUMO-WNK1(2241-2266) D2249A (human) This paper N/A
pTP464_His14-bdSUMO-WNK1(2241-2266) D2249K (human) This paper N/A
pTP465_His14-bdSUMO-WNK1(2241-2266) D2260A (human) This paper N/A
pTP466_His14-bdSUMO-WNK1(2241-2266) D2260K (human) This paper N/A
pTP522_His14-bdSUMO-WNK1(2241-2266) T2247A (human) This paper N/A
pTP523_His14-bdSUMO-WNK1(2241-2266) T2247K (human) This paper N/A
pTP173_His14-bdSUMO-WNK2(2153-2178) (human) This paper N/A
pTP174_His14-bdSUMO-WNK3(1641-1666) (human) This paper N/A
Software and algorithms
FlowJo FlowJo https://www.flowjo.com/
UCSF Chimera UCSF https://www.cgl.ucsf.edu/chimera/
Pymol Schrödinger https://pymol.org/2/
Adobe Illustrator Adobe https://www.adobe.com/uk/creativecloud.html
ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/
Zeiss Zen Zeiss https://www.zeiss.com/microscopy/us/products/microscope-software/zen.html
Other
SuperSignal West Pico Chemiluminescent substrate Thermo Fisher Scientific Cat# 34080
Rabbit Reticulocyte Lysate Mix Sharma et al., 2010 N/A
Canine rough microsomes Walter and Blobel, 1983 N/A
PURExpress ΔRF123 Kit New England Biolabs Cat# E6850S
TransIT-293 transfection reagent Mirus Cat# MIR2705
Lipofectamine 3000 Thermo Scientific Cat# L3000015
RNAiMAX lipofectamine Thermo Scientific Cat# 13778150
DMEM, high glucose, GlutaMAX Supplement, pyruvate Thermo Scientific Cat# 10569010
DMEM, high glucose, no glutamine, no methionine, no cystine Thermo Scientific Cat# 21013024
Expi293™ Expression Medium Thermo Scientific Cat# A1435102
FreeStyle™ 293 Expression Medium Thermo Scientific Cat# 12338026
Tetracycline-free Fetal Calf Serum (FCS) BioSera Cat# FB-1001T/500