KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Rabbit polyclonal anti-WNK1 | Bethyl | Cat# A301-515A, RRID:AB_999680 |
| Rabbit polyclonal anti-EMC2 | Proteintech | Cat# 25443-1-AP, RRID:AB_2750836 |
| Mouse monoclonal anti-EMC3 | Proteintech | Cat# 67205-1-Ig, RRID:AB_2882498 |
| Rabbit polyclonal anti-EMC4 | Proteintech | Cat# 27708-1-AP, RRID:AB_2880950 |
| Rabbit polyclonal anti-EMC5 | Bethyl | Cat# A305-833A-M, RRID:AB_2890207 |
| Rabbit polyclonal anti-EMC6 | Abcam | Cat# ab84902, RRID:AB_1925516 |
| Rabbit polyclonal anti-EMC8 | Proteintech | Cat# 19889-1-AP, RRID:AB_2878618 |
| Rabbit polyclonal anti-FDFT1 | Bethyl | Cat# A305-361A, RRID:AB_2631752 |
| Rabbit polyclonal anti-VAMP2 | Cell Signaling Technology | Cat# 13508, RRID:AB_2798240 |
| Rabbit polyclonal anti-Hsp70 | Enzo Life Sciences | Cat# ADI-SPA-812, RRID:AB_10013742 |
| Rabbit polyclonal anti-Ube2O | Bethyl | Cat# A301-873-A-T, RRID:AB_2780177 |
| Mouse monoclonal anti-Bip | BD Biosciences | Cat# 610978, RRID:AB_398291 |
| Rabbit polyclonal anti-AE2 | Bethyl | Cat# A304-502A, RRID:AB_2620696 |
| Rabbit monoclonal anti-NKCC1 | Cell Signaling Technology | Cat# 8351, RRID:AB_10830068 |
| Rabbit polyclonal anti-CLINT1 | Bethyl | Cat# A301-926A, RRID:AB_1524117 |
| Rabbit polyclonal anti-γ-AP1 | Bethyl | Cat# A304-771A, RRID:AB_2620966 |
| Mouse monoclonal anti-FLAG M2 | Sigma-Aldrich | Cat# F1804, RRID:AB_262044 |
| Rabbit polyclonal anti-Clathrin Heavy Chain | Bethyl | Cat# A304-743A, RRID:AB_2620938 |
| Rabbit monoclonal anti-Rps24 | Abcam | Cat# ab196652, RRID:AB_2714188 |
| Mouse monoclonal anti-α-Tubulin | Sigma-Aldrich | Cat# T9026, RRID:AB_477593 |
| Rabbit monoclonal anti-β-Actin | Cell Signaling Technology | Cat# 8457, RRID:AB_10950489 |
| Rabbit polyclonal anti-MKRN1 | Bethyl | Cat# A300-990A RRID:AB_2142814 |
| Rabbit polyclonal anti-HUWE1 | Proteintech | Cat# 19430-1-AP, RRID:AB_2878579 |
| Sheep polyclonal anti-SPAK/OSR1 | MRC PPU Reagents and Services | Cat# S637B, RRID:AB_2890208 |
| Sheep polyclonal anti-SPAK/OSR1 pSer373/pSer325 | Sigma-Aldrich | Cat# 07-2273, RRID:AB_11205577 |
| Rabbit polyclonal anti-GFP | Gift from Ramanujan Hegde (Chakrabarti and Hegde, 2009) | N/A |
| Rabbit polyclonal anti-TRAPα | Gift from Ramanujan Hegde | N/A |
| Rabbit polyclonal anti-BAG6 | Gift from Ramanujan Hegde (Mariappan et al., 2010) | N/A |
| Rabbit polyclonal anti-Sec61β | Gift from Ramanujan Hegde | N/A |
| HRP-conjugated mouse monoclonal anti-HA | Sigma-Aldrich | Cat# H6533, RRID:AB_439705 |
| HRP-conjugated mouse monoclonal anti-FLAG M2 | Sigma-Aldrich | Cat# A8592, RRID:AB_439702 |
| HRP-conjugated goat anti-rabbit IgG | BioRad | Cat# 170-6515, RRID:AB_11125142 |
| HRP-conjugated goat anti-mouse IgG | BioRad | Cat# 172-1011, RRID:AB_11125936 |
| Donkey polyclonal anti-mouse IgG Alexa Fluor 488 | Thermo Scientific | Cat# A-21202, RRID:AB_141607 |
| Donkey polyclonal anti-rabbit IgG Alexa Fluor 647 | Thermo Scientific | Cat# A-31573, RRID:AB_2536183 |
| Chemicals, peptides, and recombinant proteins | ||
| Doxycycline | Sigma-Aldrich | Cat# D9891, CAS: 24390-14-5 |
| Digitonin | Millipore | Cat# 300410, CAS: 11024-24-1 |
| LMNG | Anatrace | Cat# NG310, CAS: 1257852-96-2 |
| Complete EDTA-free protease inhibitor cocktail | Roche | Cat# 11873580001 |
| Pierce Streptavidin Magnetic Beads | Thermo Scientific | Cat# 88817 |
| Anti-Flag M2 affinity resin | Sigma-Aldrich | Cat# A2220 |
| 3xFlag peptide | Sigma-Aldrich | Cat# F4799 |
| Anti-HA agarose | Sigma-Aldrich | Cat# A2095 |
| HA peptide | Thermo Scientific | Cat# 26184 |
| Ni-NTA agarose | QIAGEN | Cat# 30210 |
| Glutathione sepharose 4B | GE Healthcare | Cat# 17-0756-05 |
| L-Glutathione, reduced | Sigma-Aldrich | Cat# G4251 |
| Biotin | Sigma-Aldrich | Cat# B4501 |
| PMSF | Thermo Scientific | Cat# 36978 |
| EasyTag L-[35S]-Methionine | Perkin Elmer | Cat# NEG709A005MC |
| ATP, [γ-32P] | Perkin Elmer | Cat# BLU002A100UC |
| PEI MAX Mw 40,000 | Polysciences | Cat# 24765-1, CAS: 49553-93-7 |
| Poly-D-lysine | GIBCO | Cat# A3890401 |
| Amino acid kit | Sigma-Aldrich | Cat# 09416 |
| PhosSTOP Phosphatase inhibitor tablets | Roche | Cat# 4906845001 |
| Puromycin Dihydrochloride | Thermo Scientific | Cat# A1113803 |
| Hygromycin B | Millipore | Cat# 400051-100KU, CAS: 31282-04-9 |
| Blasticidin S | Thermo Scientific | Cat# A1113903, CAS: 3513-03-9 |
| MG132 Proteasomal Inhibitor | Calbiochem | Cat# 474790 |
| Bortezomib | Calbiochem | Cat# 504314, CAS 179324-69-7 |
| PR619 | Sigma-Aldrich | Cat# SML0430 |
| WNK463 | MedChemExpress | Cat# HY-100626, CAS 2012607-27-9 |
| 4-Benzoylphenylalanine (Bpa) | Bachem | Cat# 4017646.0001, CAS 104504-45-2 |
| DAPI | Sigma-Aldrich | Cat# MBD0015 |
| SlowFade Gold | Thermo Scientific | Cat# S36936 |
| Sytox Blue Dead Cell Stain | Thermo Scientific | Cat# 34857 |
| Creatine phosphate | Roche | Cat# 621714 |
| Creatine kinase | Roche | Cat# 127566 |
| His-Ubiquitin | Boston Biochem | Cat# U-530 |
| UbcH5a | Boston Biochem | Cat# E2-616 |
| GST-UBE1 (human) | Boston Biochem | Cat# E-306 |
| S7 Micrococcal Nuclease | Roche | Cat# 10107921001 |
| RNasin | Promega | Cat# N251 |
| SP6 Polymerase | New England Biolabs | Cat# M0207L |
| DNAse I | New England Biolabs | Cat# M0303L |
| 3xFLAG-Calmodulin | Shao et al., 2017 | N/A |
| Bpa-RS | Shao et al., 2017 | N/A |
| Amber suppressor tRNA | Shao et al., 2017 | N/A |
| Deposited data | ||
| CryoEM structure of the human EMC | Pleiner et al., 2020 | PDB 6WW7 |
| CryoEM structure of the yeast EMC | Bai et al., 2020 | PDB 6WB9 |
| Experimental models: cell lines | ||
| Flp-In T-REx 293 | Thermo Scientific | Cat# R78007, RRID: CVCL_U421 |
| HeLa | ATCC | Cat# CCL-2, RRID:CVCL_0030 |
| HeLa EMC2-GFP knock-in | This paper | N/A |
| HeLa Flp-In T-REx | Gift from Christian Schlieker | N/A |
| Expi 293F | Thermo Scientific | Cat# A14527, RRID:CVCL_D615 |
| Flp-In T-REx 293 dox inducible GFP-2A-mCherry | This paper | N/A |
| Flp-In T-REx 293 dox inducible GFP-EMC2-2A-mCherry | Pleiner et al., 2020 | N/A |
| Flp-In T-REx 293 dox inducible EMC4-GFP-2A-mCherry | This paper | N/A |
| Flp-In T-REx 293 dox inducible EMC5-GFP-2A-mCherry | This paper | N/A |
| Flp-In T-REx 293 dox inducible GFP-NKCC1-2A-mCherry | This paper | N/A |
| Flp-In T-REx 293 dox inducible EMC5-3xFLAG | This paper | N/A |
| Flp-In T-REx 293 dox inducible GFP-WNK1 | This paper | N/A |
| Flp-In T-REx 293 dox inducible 3xFLAG-WNK1 | This paper | N/A |
| Flp-In T-REx 293 dox inducible 3xFLAG-WNK1 (L2250K, L2253K, W2257K) | This paper | N/A |
| HeLa Flp-In dox inducible GFP-2A-mCherry-FDFT1(SQS)(378-410)-Opsin | This paper | N/A |
| HeLa Flp-In dox inducible GFP-2A-mCherry-VAMP2(91-114)-Opsin | This paper | N/A |
| HeLa Flp-In dox inducible TRAM2-GFP-2A-mCherry | This paper | N/A |
| HeLa Flp-In dox inducible OPRK1-GFP-2A-mCherry | This paper | N/A |
| E. coli Rosetta™ 2(DE3) | Novagen | Cat# 71400 |
| BL21 Competent E. coli | New England Biolabs | Cat# C2530H |
| NEBExpress® Iq Competent E. coli | New England Biolabs | Cat# C3037I |
| Oligonucleotides | ||
| On-Targetplus siRNA against WNK1: GCAGUUGUCUCAAUAUCUA | Dharmacon | Cat# J-005362-05-0002 |
| On-Targetplus siRNA against WNK1: GCAGGAGUGUCUAGUUAUA | Dharmacon | Cat# J-005362-06-0002 |
| On-Targetplus Non-targeting control siRNA #1: UGGUUUACAUGUCGACUAA | Dharmacon | Cat# D-001810-01-05 |
| Silencer Select siRNA against WNK1: CAUCAUCCCUUAGUCUACAtt | Thermo Scientific | Cat# s35233 |
| Silencer Select siRNA against WNK1: CCAGCGUAGUUUCAAGUAUtt | Thermo Scientific | Cat# s35234 |
| Silencer Select siRNA against WNK1: CAAUGAGUCAGAUAUCGAAtt | Thermo Scientific | Cat# s35235 |
| Silencer Select siRNA against EMC2: CAAUGAACAUGACUAUGCAtt | Thermo Scientific | Cat# s18670 |
| Silencer Select siRNA against EMC5: GGCCUUUGCAGUUACCUGUtt | Thermo Scientific | Cat# s41131 |
| Silencer Select negative control no. 2 siRNA | Thermo Scientific | Cat# 4390846 |
| sgRNA against EMC2 C-terminus for knock-in: TTGCAGATCACCCAGTCTTA | This paper | N/A |
| Recombinant DNA | ||
| pcDNA3.1 HA CFP hsNKCC1 WT – source of NKCC1 coding sequence | Gift from Biff Forbush (Somasekharan et al., 2013) | Addgene ID #49077 |
| pCRISPaint-TagBFP – source of TagBFP coding sequence | Gift from Veit Hornung (Schmid-Burgk et al., 2016) | Addgene ID #67168 |
| pSpCas9(BB)-2A-Puro (pX459) | Gift from Feng Zhang (Ran et al., 2013) | Addgene ID #48139 |
| pTP602_gRNA against human EMC2 C-terminus used for knock-in in pX459 | This paper | N/A |
| pTP600_EMC2-GFP knock-in donor plasmid | This paper | N/A |
| MISSION® pLKO.1-puro Non-Mammalian shRNA Control Plasmid | Sigma-Aldrich | Cat# SHC002 |
| TRC1.5_pLKO-puro Mission shRNA targeting WNK1 | Sigma-Aldrich | Cat# TRCN0000000919 |
| pCMV6-Entry-WNK1-Myc-1xFLAG (human) ORF clone | Origene | Cat# RC218208 |
| pTP061_pCMV6-Entry-WNK1(1-2106)-Myc-1xFLAG (human) | This paper | N/A |
| pTP062_pCMV6-Entry-WNK1(1-2200)-Myc-1xFLAG (human) | This paper | N/A |
| pTP063_pCMV6-Entry-WNK1(1-2272)-Myc-1xFLAG (human) | This paper | N/A |
| pcDNA5/FRT/TO | Thermo Scientific | Cat# V652020 |
| Flp-Recombinase pOG44 | Thermo Scientific | Cat# V600520 |
| pTP045_GFP-2A-mCherry in pcDNA5/FRT/TO | This paper | N/A |
| pTP021_GFP-EMC2-2A-mCherry in pcDNA5/FRT/TO | Pleiner et al., 2020 | N/A |
| pTP244_EMC4-GFP-2A-mCherry in pcDNA5/FRT/TO | This paper | N/A |
| pTP022_EMC5-GFP-2A-mCherry in pcDNA5/FRT/TO | This paper | N/A |
| pTP092_GFP-NKCC1-2A-mCherry in pcDNA5/FRT/TO | This paper | N/A |
| pTP004_EMC5-3xFLAG in pcDNA5/FRT/TO | This paper | N/A |
| pTP428_GFP-WNK1 in pcDNA5/FRT/TO | This paper | N/A |
| pTP047_3xFLAG-WNK1 in pcDNA5/FRT/TO | This paper | N/A |
| pTP115_3xFLAG-WNK1 (L2250K, L2253K, W2257K) in pcDNA5/FRT/TO | This paper | N/A |
| pTP064_GFP-2A-mCherry-FDFT1(SQS)(378-410)-Opsin in pcDNA5/FRT/TO | This paper | N/A |
| pTP040_GFP-2A-mCherry-VAMP2(91-114)-Opsin in pcDNA5/FRT/TO | This paper | N/A |
| pTP131_TRAM2-GFP-2A-mCherry in pcDNA5/FRT/TO | This paper | N/A |
| pTP498_OPRK1-GFP-2A-mCherry in pcDNA5/FRT/TO | This paper | N/A |
| pTP604_3xHA-Ubiquitin in pcDNA5/FRT/TO | This paper | N/A |
| pcDNA3.1 | Thermo Scientific | Cat# V79020 |
| pTP123_3xFLAG-TagBFP-WNK1 in pcDNA3.1 | This paper | N/A |
| pTP118_3xFLAG-TagBFP-WNK1(2241-2266) in pcDNA3.1 | This paper | N/A |
| pTP182_3xFLAG-TagBFP-WNK1(2241-2266) (L2250K, L2253K, W2257K) in pcDNA3.1 | This paper | N/A |
| pRMV409_3xFLAG-TagBFP in pcDNA3.1 | This paper | N/A |
| pHAGE2 lentiviral transfer vector | Gift from Magnus A. Hoffmann and Pamela Bjorkman | N/A |
| pΔ8.9 and pVSV-G packaging plasmids | Gift from Carlos Lois | N/A |
| pTP340_3xFLAG-TagBFP-EMC2 (human) in pHAGE2 | This paper | N/A |
| pTP377_3xFLAG-TagBFP-EMC2 (E156A) (human) in pHAGE2 | This paper | N/A |
| pTP461_3xFLAG-TagBFP-EMC2 (E180A) (human) in pHAGE2 | This paper | N/A |
| pTP355_EMC5-TagBFP-3xFLAG (human) in pHAGE2 | This paper | N/A |
| pTP357_EMC5(F90A)-TagBFP-3xFLAG (human) in pHAGE2 | This paper | N/A |
| pTP360_EMC5(F93A)-TagBFP-3xFLAG (human) in pHAGE2 | This paper | N/A |
| SP64 vector | Promega | Cat# P1241 |
| pRMV188_3xFLAG-hsSec61b(2-13)-ggVillin-1(792-826)-hsSec61beta(13-68) in SP64 | Shao et al., 2013 | N/A |
| RMV225_3xFLAG-hsSec61beta(2-end) in SP64 | This paper | N/A |
| pTP007_3xHA-EMC2 (human) in SP64 | This paper | N/A |
| pTP345_3xHA-EMC2 (Y171A) (human) in SP64 | This paper | N/A |
| pTP369_3xHA-EMC2 (Y200A) (human) in SP64 | This paper | N/A |
| pTP332_3xHA-EMC2 (R227A) (human) in SP64 | This paper | N/A |
| pTP370_3xHA-EMC2 (R28A) (human) in SP64 | This paper | N/A |
| pTP342_3xHA-EMC2 (E156A) (human) in SP64 | This paper | N/A |
| pTP343_3xHA-EMC2 (E160A) (human) in SP64 | This paper | N/A |
| pTP367_3xHA-EMC2 (E180A) (human) in SP64 | This paper | N/A |
| pTP368_3xHA-EMC2 (W259A) (human) in SP64 | This paper | N/A |
| pTP008_3xHA-EMC8 (human) in SP64 | This paper | N/A |
| pTP361_hsEMC5-3xFLAG (human) in SP64 | This paper | N/A |
| pTP363_hsEMC5(F90A)-3xFLAG (human) in SP64 | This paper | N/A |
| pTP366_hsEMC5(F93A)-3xFLAG (human) in SP64 | This paper | N/A |
| gb001_SP6 3xFLAG-EMC2 (human) gblock | This paper | N/A |
| gb033_SP6 EMC3-3xFLAG (human) gblock | This paper | N/A |
| gb076_SP6 3xHA-EMC2 (yeast) gblock | This paper | N/A |
| gb077_SP6 EMC5-3xFLAG (yeast) gblock | This paper | N/A |
| gb078_SP6 EMC3-3xFLAG (yeast) gblock | This paper | N/A |
| T7 PURExpress plasmid | New England Biolabs | Cat# E6800S |
| pRMV210_T7 3xHA-Sec61β(2-end)(F85Amber) human in T7 PURExpress | This paper | N/A |
| pTP112_T7 3xFLAG-Sec61β(2-59)-SQS(378-410)(Y400Amber)-Opsin in T7 PURExpress | This paper | N/A |
| All E. coli expression constructs in pQE80-derivative | Qiagen | N/A |
| pTP105_His14-bdNEDD8-EMC2 (human) | This paper | N/A |
| pTP030_His14-bdNEDD8-3xFLAG-EMC2 (human) | This paper | N/A |
| pTP024_His14-bdNEDD8-EMC8 (human) | This paper | N/A |
| pTP031_His14-bdNEDD8-3xFLAG-EMC8 (human) | This paper | N/A |
| pTP083_His14-bdSUMO-EMC3(35-117)-3xFLAG (human) | This paper | N/A |
| pTP128_His14-bdSUMO-EMC3(196-261)-3xFLAG (human) | This paper | N/A |
| pTP354_His14-bdSUMO-EMC5(66-131)-3xFLAG (human) | This paper | N/A |
| pTP189_His14-bdSUMO-OSR1(2-end)(D164A) (human) | This paper | N/A |
| pTP396_His14-Avi-Spacer-SUMOEu1-anti-GFP nanobody 3K1K | Pleiner et al., 2015; Pleiner et al., 2020 | Addgene ID #149336 |
| pTP264_His14-bdNEDD8-BirA (E. coli) | Gift from Dirk Görlich (Pleiner et al., 2015) | Addgene ID #149334 |
| pAV286_His14-Tev-SENPEuB | Gift from Dirk Görlich (Pleiner et al., 2020; Vera Rodriguez et al., 2019) | Addgene ID #149333 |
| pDG02583_His14-MBP-bdSUMO-bdNEPD1 | Gift from Dirk Görlich (Pleiner et al., 2018) | Addgene ID #104129 |
| pSF1389_His14-Tev-bdSENP1 | Gift from Dirk Görlich (Frey and Görlich, 2014) | Addgene ID #104962 |
| pTP072_His14-bdSUMO-WNK1(2241-2266)-3xFLAG (human) | This paper | N/A |
| pTP096_His14-bdSUMO-WNK1(2241-2266)-3xHA (human) | This paper | N/A |
| pTP076_His14-bdSUMO-WNK1(2241-2266) (human) | This paper | N/A |
| pTP107_His14-bdSUMO-WNK1(2241-2266) L2250K) (human) | This paper | N/A |
| pTP108_His14-bdSUMO-WNK1(2241-2266) L2253K (human) | This paper | N/A |
| pTP109_His14-bdSUMO-WNK1(2241-2266) W2257K (human) | This paper | N/A |
| pTP322_His14-bdSUMO-WNK1(2241-2266) F2246K (human) | This paper | N/A |
| pTP323_His14-bdSUMO-WNK1(2241-2266) D2248K (human) | This paper | N/A |
| pTP324_His14-bdSUMO-WNK1(2241-2266) H2251K (human) | This paper | N/A |
| pTP325_His14-bdSUMO-WNK1(2241-2266) W2257L (human) | This paper | N/A |
| pTP326_His14-bdSUMO-WNK1(2241-2266) W2257A (human) | This paper | N/A |
| pTP327_His14-bdSUMO-WNK1(2241-2266) L2264K (human) | This paper | N/A |
| pTP463_His14-bdSUMO-WNK1(2241-2266) D2249A (human) | This paper | N/A |
| pTP464_His14-bdSUMO-WNK1(2241-2266) D2249K (human) | This paper | N/A |
| pTP465_His14-bdSUMO-WNK1(2241-2266) D2260A (human) | This paper | N/A |
| pTP466_His14-bdSUMO-WNK1(2241-2266) D2260K (human) | This paper | N/A |
| pTP522_His14-bdSUMO-WNK1(2241-2266) T2247A (human) | This paper | N/A |
| pTP523_His14-bdSUMO-WNK1(2241-2266) T2247K (human) | This paper | N/A |
| pTP173_His14-bdSUMO-WNK2(2153-2178) (human) | This paper | N/A |
| pTP174_His14-bdSUMO-WNK3(1641-1666) (human) | This paper | N/A |
| Software and algorithms | ||
| FlowJo | FlowJo | https://www.flowjo.com/ |
| UCSF Chimera | UCSF | https://www.cgl.ucsf.edu/chimera/ |
| Pymol | Schrödinger | https://pymol.org/2/ |
| Adobe Illustrator | Adobe | https://www.adobe.com/uk/creativecloud.html |
| ImageJ | Schneider et al., 2012 | https://imagej.nih.gov/ij/ |
| Zeiss Zen | Zeiss | https://www.zeiss.com/microscopy/us/products/microscope-software/zen.html |
| Other | ||
| SuperSignal West Pico Chemiluminescent substrate | Thermo Fisher Scientific | Cat# 34080 |
| Rabbit Reticulocyte Lysate Mix | Sharma et al., 2010 | N/A |
| Canine rough microsomes | Walter and Blobel, 1983 | N/A |
| PURExpress ΔRF123 Kit | New England Biolabs | Cat# E6850S |
| TransIT-293 transfection reagent | Mirus | Cat# MIR2705 |
| Lipofectamine 3000 | Thermo Scientific | Cat# L3000015 |
| RNAiMAX lipofectamine | Thermo Scientific | Cat# 13778150 |
| DMEM, high glucose, GlutaMAX Supplement, pyruvate | Thermo Scientific | Cat# 10569010 |
| DMEM, high glucose, no glutamine, no methionine, no cystine | Thermo Scientific | Cat# 21013024 |
| Expi293™ Expression Medium | Thermo Scientific | Cat# A1435102 |
| FreeStyle™ 293 Expression Medium | Thermo Scientific | Cat# 12338026 |
| Tetracycline-free Fetal Calf Serum (FCS) | BioSera | Cat# FB-1001T/500 |