Abstract
Colorectal cancer (CRC) is one of the most prevalent diagnosed cancers and a common cause of cancer-related mortality. Despite effective clinical responses, a large proportion of patients undergo resistance to radiation therapy. Therefore, the identification of efficient targeted therapy strategies would be beneficial to overcome cancer radioresistance. Doublecortin-like kinase 1 (DCLK1) is an intestinal and pancreatic stem cell marker that showed overexpression in a variety of cancers. The transfection of DCLK1 siRNA to normal HCT-116 cells was performed, and then cells were irradiated with X-rays. The effects of DCLK1 inhibition on cell survival, apoptosis, cell cycle, DNA damage response (ATM and γH2AX proteins), epithelial-mesenchymal transition (EMT) related genes (vimentin, N‐cadherin, and E-cadherin), cancer stem cells markers (CD44, CD133, ALDH1, and BMI1), and β‐catenin signaling pathway (β‐catenin) were evaluated. DCLK1 siRNA downregulated DCLK1 expression in HCT-116 cells at both mRNA and protein levels (P <0.01). Colony formation assay showed a significantly reduced cell survival in the DCLK1 siRNA transfected group in comparison with the control group following exposure to 4 and 6 Gy doses of irradiation (P <0.01). Moreover, the expression of cancer stem cells markers (P <0.01), EMT related genes (P <0.01), and DNA repair proteins including pATM (P <0.01) and γH2AX (P <0.001) were significantly decreased in the transfected cells in comparison with the nontransfected group after radiation. Finally, the cell apoptosis rate (P <0.01) and the number of cells in the G0/G1 phase in the silencing DCLK1 group was increased (P <0.01). These findings suggest that DCLK1 can be considered a promising therapeutic target for the treatment of radioresistant human CRC.
Key Words: DCLK1, ionizing radiation, colorectal cancer, radiosensitivity
Dolorectal cancer (CRC) is considered the third leading cause of cancer-related death for both men and women worldwide (1). Radiotherapy (RT) as a highly effective treatment approach for cancer has been broadly used in the clinic for over 100 years, where directly or indirectly mediating tumor cell death via inducing multiple types of DNA damage and genome instability (2). Indeed, RT improves the efficacy of surgery by shrinking the tumor before surgery or removing the remaining microscopic tumor cells afterward (3). Despite promising achievement in radiation therapy for controling malignant cells, and curative potentials in several localized cancers, prognosis and the 5-year survival rate remained poor, largely due to intrinsic cellular resistance (4). Therefore, in order to enhance the efficacy of RT, more therapeutic strategies are required for promoting the ionizing radiation (IR) sensitivity of CRC and to overcome IR resistance (5).
A growing body of evidence reveals that various factors including double-strand break (DSB) repair pathway through homologous recombination and nonhomologous end-joining, tumor microenvironment, various deregulated signaling pathways (e.g., AKT or NF-κB,), micro RNA dysregulation, redistribution of the cell cycle, hypoxia, and apoptosis contribute to cellular resistance against radiation (6, 7). Besides, cancer stem cells (CSCs) or tumor-initiating cells, and the epithelial-mesenchymal transition (EMT) enable radioresistant tumor cells metastasis after IR exposure (8). Discovering and targeting molecules and signaling pathways associated with these barriers are essential for developing new beneficial radiosensitizers, and improving the efficacy ofIR (9).
Doublecortin-like kinase 1 (DCLK1) as a tuft cell marker in the small intestine is a member of the microtubule-associated protein kinase superfamily that regulates embryonic cortical development and neuronal process (10). Cumulative evidence has verified that DCLK1 expression can support CSCs self-renewal, cancer growth, EMT, and metastasis in both early and advanced cancer stages (11). Moreover, EMT and CSCs that play key roles in the development and progression of cancer, are involved in multimodal therapy resistance and relapse (12).
Here, we hypothesized that IR-induced ataxia telangiectasia mutated (ATM) activation following direct interaction with DCLK1 may lead to the repair of damaged DNA, and increase the survival of cancer cells. Therefore, the present study aimed to explore whether DCLK1 inhibition impacts radiosensitivity, double strand breack (DSB) repair, cell cycle, cell survival, EMT, and CSCs expression in HCT-116 CRC cell line, and elucidatethe underlying mechanisms through in vitro investigations.
Materials and methods
Cell culture and transfection
The human HCT-116 CRC cell line was obtained from the National Cell Bank, Pasteur Institute, Tehran, Iran (http://fa.pasteur.ac.ir/), and radioresistant cells HCT-116 (RR−HCT-116) were generated by fractional radiation (13). The cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM; Gibco, USA) supplemented with 10% fetal bovine serum (FBS; Gibco, USA), and 1% penicillin or streptomycin, thereafter incubated in a humidified atmosphere of 5% CO2 at 37 °C. The sequence of siRNA against DCLK1 (accession No. NM_001195415) (5'GGUUUAUAACUUCGA CACATT3') and HiPerFect siRNA transfection reagent were obtained from QIAGEN (Hilden, Germany). To perform transfection, HCT-116 cells were seeded into six-well plates at a density of 3×105 cells per well with no antibiotic and FBS added. When the cells reached ~60–70% confluency, they were transfected with siRNA (5 nM) using 12 μL of the transfection reagent, following the manufacturer’s protocol (QIAGEN, Hilden, Germany).
Colony ‐ forming assay
IR was delivered using a synergy linear accelerator with an agility collimating device (Elekta AB, Stockholm, Sweden, 200 MU/min dose rate) at the specified dose. The cells were counted and replated in 6-well plates at 24 h after transfection, then incubated for an additional 24 h. Next, the cells were exposed to IR in a single fraction, incubated for seven days, followed by staining with crystal violet. Using Olympus CKX53 inverted microscope (Nagano Olympus Co. Japan), the colonies (>50 cells) were quantified, and to obtain the average colony formation rate the experiment was repeated in triplicate. The following formula was used: plating efficiency (PE)= colony number/seeded cells number ×100%; survival fraction (SF)= the number of colonies formed by irradiated cells in response to a particular dose/seeded cells number × PE.
Flow cytometry ‐ based cell ‐ cycle and apoptosis analysis
Cell cycle analysis was carried out by quantification of DNA content staining through propidium iodide (PI; Abcam, USA), according to the manufacturer’s instructions. HCT-116 cells in the exponential growth phase were plated in six-well plates and transfected as mentioned earlier. The cells were collected and washed twice with phosphate-buffered saline (PBS) at 48 h post-exposure to 6 Gy radiation, then fixed with 70% ethanol at 4°C overnight. The cells incubation was conducted with DNAse-free RNAse (Sigma-Aldrich, Taufkirchen, Germany) at room temperature in the dark condition for 30 min and later stained with PI. The cell cycle status was evaluated by flow cytometry.
To analysis the rate of apoptosis, HCT-116 cells were grown in six-well plates, transfected and treated as mentioned earlier. Forty-eight hours after radiation, the cells stained with annexin V and PI were assessed by Attune NxT acoustic focusing cytometer (Invitrogen, USA). All the results were analyzed using Flowjo 7.6 software. (FlowJo, LLC, Ashland, OR, USA). Each experiment was repeated three times.
RNA isolation and reverse-transcription quantit-ative PCR (RT ‐ qPCR)
Per the manufacturer’s instructions, total RNA was isolated from HCT-116 cells using RNX‐Plus Kit (Cinnagen, Tehran, Iran). RNA quantity and quality were evaluated using a NanoDrop Spectrophotometer (Thermo Fisher Scientific, USA). The complementary DNA (cDNA) was synthesized using PrimeScript™ RT reagent Kit (TaKaRa, Japan) according to the manufacturer’s protocol. A master mix (10 μL in total) containing 5X PrimeScript Buffer (2 μL), RT mix (0.5 μL), oligo dT primer (0.5 μL), random hexamer primer (0.5 μL), 500 ng of total RNA (2-4 μL), and nuclease-free water (2.5-4.5 μL) was prepared on ice. The reaction was incubated at 37oC for 15 min, 85oC for 5 s, and at 4oC for 5 min. The RT-qPCR was conducted to assess the mRNA expression of
the target genes (Table 1) in samples. For each PCR reaction, 1 μL of cDNA was added to SYBR Premix Ex Taq II Master Mix (Takara, Japan), PCR primers (10 pmol), and nuclease-free water in a total volume of 10 μL. The cycling program was performed as follows: initial denaturation at 95°C followed by 40 cycles of denaturation for 5 s at 95°C, annealing for 30 s at 60°C, extension for 30 s at 72°C. RT-qPCR assays were performed in triplicate, and the mean values were used to calculate mRNA expression. Glyceraldehyde 3‐phosphate dehydrogenase (GAPDH) was applied as an internal control gene. The differential expression of genes was calculated by the 2−ΔΔCT method.
Table 1.
Primer sequences for qRT-PCR
| Reverse | Forward | Gene |
|---|---|---|
| CAGGAAGGTCTCATTGAACAC | TTGCTCCAGATCGTTAGAAGG | DCLK1 |
| AACGCCTTGTCCTTGGTAG | GAGTCGGAAACTGGCAGATAG | CD133 |
| GAAGTTGCTGATGACCCATTTAC | CATCCACAGTTTCCTCACATTTC | BMI1 |
| GCCCTTCTATGAACCCATACC | AATGGTCGCTACAGCATCTC | CD44 |
| CTCGGAAGCATCCATAGTACG | GCCAGGTAGAAGAAGGAGATAAG | ALDH1 |
| GAGGATGGTGTAAGCGATGG | AGAACGCATTGCCACATACA | E-cadherin |
| CGTTGATAACCTGTCCATC | CATTGAGATTGCCACCTAC | Vimentin |
| CCCACAATCCTGTCCACATC | ATTCGGGTAATCCTCCCAAATC | N-cadherin |
| CCTTCCATCCCTTCCTGTTTAG | CTTCACCTGACAGATCCAAGTC | β ‐ catenin |
| TTGACGGTGCCATGGAATTT | GCCATCAATGACCCC-TTCATT | GAPDH |
Western blot analysis
Cells were harvested at 72 h after transfection (i.e. 48 h post-exposure to 6 Gy radiation), and total protein was isolated using RIPA lysis buffer (Santa Cruz Biotechnology, Dallas, USA) containing protease and phosphatase inhibitors. The protein concentration was quantified by Bradford protein assay (14). Equal amounts of proteins (~50 μg) were separated on 10% SDS-PAGE and transferred onto nitrocellulose. Each sample was loaded three times. Non-specific binding was blocked by membrane incubation in 5% skimmed milk (Merck, Darmstadt, Germany) and membranes were probed overnight at 4°C with the following primary antibodies: Anti-DCLK1 (1:5000, Abcam, USA), anti-GAPDH (1:10000, Abcam, USA), anti phospho ATM (ser1981) (pATM) (1:50000, Abcam, USA), anti γH2AX (1:1000, Abcam, USA). The secondary horseradish peroxidase-conjugated goat antirabbit antibody was used to incubate the membrane for 1 h at room temperature, and immunoreactivity was detected using an enhanced chemiluminescence detection kit (Amersham, USA). The band intensity was digitized and quantified by ImageJ software (National Institute of Health, Bethesda, MD, USA).
Statistical analysis
Analysis of the data between different treatment groups was conducted using the SPSS16.0 software, and the data were compared by analysis of variance (one-way ANOVA). Alpha was set at 0.05. Values are expressed as mean ± standard error.
Results
DCLK1 expression is upregulated in RR−HCT-116
To investigate the effects of DCLK1 inhibition on radioresistance in colorectal cancer cells, the expression of this gene in radioresistant and normal cells was evaluated. The results showed an upregulation of DCLK1 in radioresistant cells in comparison with normal cells (P <0.01; Figure 1A).
Fig. 1.
DCLK1 expression in radioresistant HCT-116 cells (RR-HCT-116) and effect of DCLK1 siRNA treatment on DCLK1 mRNA and protein expression. The expression levels of DCLK1 in RR-HCT-116 (A) and transfected cells (B) determined by RT-qPCR 48 h after 6 Gy radiation. (C) Western blot analysis was performed to assess protein expression of DCLK1 in transfected HCT-116 with DCLK1 siRNA and nontransfected cells 48 h after 6 Gy radiation. All quantitative data are expressed as means ± SEM of three independent experiments. **P < 0. 01 vs. control
DCLK1 siRNA downregulates DCLK1 mRNA and protein expression
Following DCLK1 expression association with radioresistance evaluation, the cells were transfected with DCLK1 siRNA, and were irradiated after 24 h. To detect the effect of siRNA-DCLK1, we examined DCLK1 gene and protein expression in the CRC cells by RT-qPCR and western blotting analysis. In the transfected HCT-116 cells, both DCLK1 mRNA and protein expression were down regulated after radiation exposure (P <0. 01; Figure 1B-C).
The inhibition of DCLK1 enhances the sensitivity of HCT-116 cells to IR treatment
To evaluate whether the inhibition of DCLK1 could enhance radiosensitivity in CRC cells, a colony formation assay was performed. Compared with the control group, the survival curve of HCT-116 cells in the DCLK1-siRNA1 group was significantly reduced following exposure to 4, and 6 Gy doses of irradiation (P<0.01; Figure 2). Microscopic observation post crystal violet staining revealed a dose dependent decrease in the number and size of the emerged colonies in the transfected group in comparison with the non-transfected group (data not shown). Thus, our results revealed that the combined treatment of DCLK1-siRNA and IR led to a significant reduction in the survival fraction of HCT-116 cells compared to the IR treatment alone (Figure 2).
Fig. 2.
Effect of DCLK1 silencing on the radiosensitivity of HCT-116 cells. (A) The survival fraction of the DCLK1siRNA transfected group was lower than the untransfected group at doses of 4 and 6 Gy. (B) Representative results of colony formation of HCT-116 cells transfected with DCLK1 siRNA, and untransfected cells. **P < 0.01 vs. the control group
Silencing DCLK1 reduces IR-induced DNA repair
To understand whether DCLK1 expression in CRC cells regulates DNA damage response following radiation exposure, western blot analysis was performed to detect the protein expression level of pATM and phosphorylated H2AX (γH2AX) 48 and 24 h post-radiation, respectively. The results showed that ATM (P <0.01) and H2AX (P <0.001) phosphorylation significantly were reduced in the transfected cell in comparison with the non-transfected group (Figure 3).
Fig. 3.
Effect of silencing DCLK1 on DNA repair protein levels. Western blot analysis was performed to evaluate the protein expression levels of phospho ATM (ser 1981) (pATM), γH2AX 48 and 24 h after 6 Gy X-ray in the presence and absence of DCLK, respectively. **P < 0.01 and ***P < 0.001 vs. control
DCLK1 silencing prolongs IR-induced G0/G1 arrest and increases apoptosis
Here, cell cycle analysis was conducted by flow cytometry to elucidate whether DCLK1 silencing combined with IR impact the cell cycle distribution of HCT-116 cells. The G0/G1 arrest of siRNA transfected cells was significantly higher at 48 h post-exposure to 6 Gy irradiation compared to the non-transfected cells (P < 0.01; Figure 4A). Therefore, it can be concluded that silencing DCLK1 increased radiosensitivity by inducing G0/G1 arrest.
Fig. 4.
Effect of DCLK1 inhibition on cell cycle and apoptosis. (A) The cell cycle of transfected cells with DCLK1 siRNA was arrested in the G0/G1 phase compared with the control group 48 h post-exposure to 6 Gy irradiation. (B) The apoptosis was analyzed by flow cytometry. The percentage of apoptotic cells markedly increased following IR combined with DCLK1 siRNA. *P < 0.05, **P < 0.01 and ***P < 0.001 vs. control
It is well known that apoptosis is one of the major IR-induced cell death. To find out the role of DCLK1 silencing in inducing apoptosis in HCT-116 cells after radiation exposure, apoptosis analysis was performed by flow cytometry. The apoptotic rate was significantly elevated in the DCLK1-siRNA treatment group 48 h post-exposure to a single dose of 6 Gy IR (P < 0.01; Figure 4B).
DLCK1 inhibition reduces CSCs and EMT related markers expression
To determine the effect of DCLK1 inhibition on CSCs and EMT-related markers, the expression patterns of key proteins were quantified. The expression of CSCs markers including CD44, prominin (CD133), aldehyde dehydrogenase 1 (ALDH1) and polycomb complex protein (BMI1) was lower in transfected cells in comparison with control cells (P <0.01; Figure 5A). RTqPCR was performed to determine EMT marker gene expression levels. As presented in Figure 5B, mesenchymal markers such as vimentin, N‐cadherin and β-catenin mRNA were down regulated (P < 0.01), while E-cadherin was up regulated (P < 0.05) (Figure 5A).
Fig. 5.
Effects of DCLK1 siRNA combined with IR on CSCs and EMT-related markers. (A) RT-PCR analysis of mRNA expression of CSCs markers of transfected HCT-116 cells with DCLK1 siRNA and untransfected cells 48 h after 6 Gy irradiation. Stemness factors mRNA levels were significantly lower in the DCLK1 siRNA group. (B) Cells were transfected with DCLK1 inhibitor for 24 h and treated with 6 Gy radiation. The mRNA levels of N-cadherin, vimentin and β-catenin were lower in cells transfected with DCLK1 siRNA. Conversely, the expression of E-cadherin in the absence of DCLK1 was higher than that in the presence of DCLK1.*P < 0.05 and **P < 0.01 vs. control
Discussion
RT is a highly effective cancer treatment in which about half of all cancer patients receive this treatment modality during their course of illness (3). Despite outstanding achievements in the treatment of CRC by radiotherapeutic procedure, nevertheless, radioresistance remains a major clinical problem (15). To overcome the radioresistance, there is an urgent need to identify the resistance effectors to suppress them and enhance the efficacy of treatment as well as to improve patient outcomes.
DCLK1 is a microtubule-associated protein in which its expression has been reported to be critically required for maintaining the growth of human colon cancer cells (16). In the present study, DCLK1 was up regulated in radioresistant HCT-116 cells; thereby most probably DCLK1 contributes to radioresistance of CRC. Very few studies have considered the relation between DCLK1 inhibition and radiosensitivity. Here, we showed that DCLK1 silencing is associated with IR sensitivity in CRC according to the dose–survival curve analysis, and this is consistent with the published studies that supported DCLK1 as an oncogene (17, 18). Our results showed a reduced ATM and γH2AX activation, a decline in EMT and CSCs markers, increased apoptotic cell numbers and G0/G1 cell cycle arrest in DCLK1 silenced cells after irradiation.
Cancer cells through the repair of therapeutically induced DNA damage are able to resist IR, thus down regulation of proteins in DNA repair pathways may boost tumor cell sensitivity to RT (19). Overexpression of DNA damage repair-related proteins is associated with increased radioresistance in several types of human cancer cells (20, 21). It is well known that in the DNA damage repair pathway, ATM as a central kinase plays a major role in controlling genome stability and cell survival (22). ATM silencing was reported to improve the therapeutic efficacy of DNA damaging agents on glioma cells and mantle cell lymphoma (5, 23). Indeed, inhibition of ATM kinase in tumor cells by preventing DNA repair, decreasing cell cycle checkpoint activation, and enhancing apoptosis led to radiosensitivity (24). In an early response to DNA damage, phosphorylation of H2AX at Ser-139 by ATM led to produce γH2AX, which creates an epigenetic signal for specific domains on downstream DNA damage repair proteins (25). Lack of H2AX is associated with genomic instability and radiation sensitivity (26). Measurement of γ-H2AX foci levels in cells provides a sensitive marker for detecting DSB repair efficiency because higher γ-H2AX expression associates with more unrepaired DSBs (27). Recently, it has been shown that ATM knockdown sensitized breast cancer cells to irradiation, and reduced phosphorylation of γ-H2AX, highlighting a strong relationship between ATM, DNA repair pathway and radioresistance (28). We observed that DCLK1 down regulation resulted in a reduction of pATM and γH2AX expression levels at 48 and 24 h post-radiation, respectively. These findings are consistent with the results from a study reporting the association of ATM phosphorylation with DCLK1 expression levels in intestinal tuft cells (29). Collectively, DCLK1 expression appears to contribute to radioresistance in CRC through additional mechanisms that maintain DNA integrity after IR exposure.
The sensitivity of cancer cells to IR depends on delays or arrests in G1, S, and G2 cell cycle phases (30). IR-induced DNA damage in proliferating cells promotes an arrest of mammalian cells at G0/G1 or G2/M phases (31). In the present study, there was an increase in the amount of G1 phase cells and decrease in S and G2 phases cells in transfected HCT-116 cells, 48 h after radiation. Many mediators are contributing to cell cycle arrest, such as IR-induced DNA damage which triggers G1 arrest through activation of the tumor suppressor gene p53 (32). Also, we found that the reduction amount of S phase cells in the transfected group in comparison with the control group may be linked to the silencing of DCLK1, revealing an improvement in sensitivity of CRC cells to IR treatment. On the other hand, an increase in the amount of S phase cells of the control group could be related to normal activation of ATM after radiation, which causes the repair of damaged cells and cell proliferation maintenance. These findings are similar to some previous studies on various cancers such as breast and cervix (33, 34).
In the present study, we investigated the impact of DCLK1 on EMT phenotype and CSCs markers. Our results revealed for the first time that inhibition of DCLK1 radiosensitized CRC cells partly by modulating EMT genes. The EMT as a highly dynamic process not only regulates normal embryonic development, wound healing and tissue regeneration, but is also involved in all stages of tumorigenesis from initiation to metastatic expansion (35). Furthermore, it has been accepted that loss of epithelial and gain of mesenchymal markers in various cancers was associated with radioresistance (36). In our study, there was a reduction in N-cadherin and vimentin expression, but up regulation of E-cadherin in DCLK1 silenced cells following radiation. Similar results were also reported in the pancreas and breast cancers (37, 38). For example, it has been indicated that sensitivity to RT was more evident in breast cancer cells expressing E-cadherin, relative to the breast cancer cells with no E-cadherin (36). However, less is known about the effect of EMT-related factors on tumor radioresistance.
It has been reported that activation of EMT increased the self-renewal and multi-differentiation potential of CSCs, and there is a close relationship between EMT and stemness factors (39). We found that the expression of CSCs markers decreased in cells transfected with DCLK1 siRNA after radiation. CSCs have unique properties such as high DNA repair capacity, high expression of anti-apoptotic genes, and reactive oxygen species (ROS) scavengers which cause cancer radioresistance (2). For example, BMI1 conferred radioresistance to CD133-positive glioblastoma multiform via either interaction with p-ATM, γH2AX, or global chromatin remodeling (40).
Accumulating evidence reveals that Wnt/β-catenin signaling as a major regulator of EMT and CSCs process may be a possible target to overcome the resistance to RT (41). β-catenin has a critical role in protecting cells from radiation-induced death through elevating DSBs repair, ROS scavenging, and suppressing apoptosis (41). In addition, the deregulation of Wnt signaling is linked with the radioresistance in numerous cancers (41, 42). It has been proven that DCLK1 protein is an essential effector in maintaining β–catenin expression for cell survival (11, 29). Similarly, we revealed that the down regulation of DCLK1 in CRC cells reduced β–catenin expression after IR.
In summary, we found for the first time that the silencing of DCLK1 enhanced the radiosensitivity of CRC cells. Decreased DSB repair, EMT and CSCs related genes down regulation, enhanced G0/G1 arrest and apoptosis, and suppressed β-catenin signaling, contribute to an increase in radiosensitivity induced by DCLK1 inhibition. Therefore, the present observation suggests that the combination of DCLK1 down regulation with ionizing radiation could serve as a promising therapeutic strategy to reverse radioresistance in CRC. Further radiobiological studies are required to highlight the role of DCLK1 and its downstream signaling pathway with radiosensitivity of other tumor cell lines.
Acknowledgment
This study was funded by a grant from Hamadan University of Medical Sciences (9611177264).
Conflict of interest
The authors declare no conflict of interest.
References
- 1.Siegel RL, Miller KD, Jemal A. Cancer statistics, 2018. CA Cancer J Clin. 2018;68:7–30. doi: 10.3322/caac.21442. [DOI] [PubMed] [Google Scholar]
- 2.Li F, Zhou K, Gao L, et al. Radiation induces the generation of cancer stem cells: A novel mechanism for cancer radioresistance. Oncol Lett. 2016;12:3059–65. doi: 10.3892/ol.2016.5124. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Baskar R, Lee KA, Yeo R, et al. Cancer and radiation therapy: current advances and future directions. Int J Med Sci. 2012;9:193–9. doi: 10.7150/ijms.3635. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Tang L, Wei F, Wu Y, et al. Role of metabolism in cancer cell radioresistance and radiosensitization methods. J Exp Clin Cancer Res. 2018;37 doi: 10.1186/s13046-018-0758-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Li Y, Li L, Li B, et al. Silencing of ataxia-telangiectasia mutated by siRNA enhances the in vitro and in vivo radiosensitivity of glioma. Oncol Rep. 2016;35:3303–12. doi: 10.3892/or.2016.4754. [DOI] [PubMed] [Google Scholar]
- 6.Liu Y, Chen X, Hu Q, et al. Resistance to radiotherapy in lung cancer. Int J Clin Exp Med. 2018;11:7628–42. [Google Scholar]
- 7.Murata K, Saga R, Monzen S, et al. Understanding the mechanism underlying the acquisition of radioresistance in human prostate cancer cells. Oncol Lett. 2019;17:5830–8. doi: 10.3892/ol.2019.10219. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Chaiswing L, Weiss HL, Jayswal RD, et al. Profiles of Radioresistance Mechanisms in Prostate Cancer. Crit Rev Oncog. 2018;23:39–67. doi: 10.1615/CritRevOncog.2018025946. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Samadi P, Afshar S, Amini R, et al. Let-7e enhances the radiosensitivity of colorectal cancer cells by directly targeting insulin-like growth factor 1 receptor. J Cell Physiol. 2019;234:10718–25. doi: 10.1002/jcp.27742. [DOI] [PubMed] [Google Scholar]
- 10.Shu T, Tseng HC, Sapir T, et al. Doublecortin-like kinase controls neurogenesis by regulating mitotic spindles and M phase progression. Neuron. 2006;49:25–39. doi: 10.1016/j.neuron.2005.10.039. [DOI] [PubMed] [Google Scholar]
- 11.Chandrakesan P, Weygant N, May R, et al. DCLK1 facilitates intestinal tumor growth via enhancing pluripotency and epithelial mesenchymal transition. Oncotarget. 2014;5:9269–80. doi: 10.18632/oncotarget.2393. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Shibue T, Weinberg RA. EMT, CSCs, and drug resistance: the mechanistic link and clinical implications. Nat Rev Clin Oncol. 2017;14:611–29. doi: 10.1038/nrclinonc.2017.44. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Khoshinani HM, Afshar S, Pashaki AS, et al. Involvement of miR-155/FOXO3a and miR-222/PTEN in acquired radioresistance of colorectal cancer cell line. Jpn J Radiol. 2017;35:664–72. doi: 10.1007/s11604-017-0679-y. [DOI] [PubMed] [Google Scholar]
- 14.Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72:248–54. doi: 10.1016/0003-2697(76)90527-3. [DOI] [PubMed] [Google Scholar]
- 15.Geng L, Wang J. Molecular effectors of radiation resistance in colorectal cancer. Precis Radiat Oncol. 2017;1:27–33. [Google Scholar]
- 16.Sarkar S, Popov VL, O'Connell MR, et al. A novel antibody against cancer stem cell biomarker, DCLK1-S, is potentially useful for assessing colon cancer risk after screening colonoscopy. Lab Invest. 2017;97:1245–61. doi: 10.1038/labinvest.2017.40. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Ali N, Chandrakesan P, Nguyen CB, et al. Inflammatory and oncogenic roles of a tumor stem cell marker doublecortin-like kinase (DCLK1) in virus-induced chronic liver diseases. Oncotarget. 2015;6:20327–44. doi: 10.18632/oncotarget.3972. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Ali N, Nguyen CB, Chandrakesan P, et al. Doublecortin-like kinase 1 promotes hepatocyte clonogenicity and oncogenic programming via non-canonical β-catenin-dependent mechanism. Sci Rep. 2020;10:1–14. doi: 10.1038/s41598-020-67401-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Gavande NS, VanderVere-Carozza PS, Hinshaw HD, et al. DNA repair targeted therapy: The past or future of cancer treatment? Pharmacol Ther. 2016;160:65–83. doi: 10.1016/j.pharmthera.2016.02.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Zhang P, Wei Y, Wang L, et al. ATM-mediated stabilization of ZEB1 promotes DNA damage response and radioresistance through CHK1. Nat Cell Biol. 2014;16:864–75. doi: 10.1038/ncb3013. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Wang W, Guo M, Xia X, et al. XRRA1 Targets ATM/CHK1/2-Mediated DNA Repair in Colorectal Cancer. Biomed Res Int. 2017;2017 doi: 10.1155/2017/5718968. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Cremona CA, Behrens A. ATM signalling and cancer. Oncogene. 2014;33:3351–60. doi: 10.1038/onc.2013.275. [DOI] [PubMed] [Google Scholar]
- 23.Golla RM, Li M, Shen Y, et al. Inhibition of poly (ADP‐ribose) polymerase (PARP) and ataxia telangiectasia mutated (ATM) on the chemosensitivity of mantle cell lymphoma to agents that induce DNA strand breaks. Hematol Oncol. 2012;30:175–9. doi: 10.1002/hon.1020. [DOI] [PubMed] [Google Scholar]
- 24.Raleigh DR, Haas-Kogan DA. Molecular targets and mechanisms of radiosensitization using DNA damage response pathways. Future Oncol. 2013;9:219–33. doi: 10.2217/fon.12.185. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Mah LJ, El-Osta A, Karagiannis TC. gammaH2AX: a sensitive molecular marker of DNA damage and repair. Leukemia. 2010;24:679–86. doi: 10.1038/leu.2010.6. [DOI] [PubMed] [Google Scholar]
- 26.Banath JP, Macphail SH, Olive PL. Radiation sensitivity, H2AX phosphorylation, and kinetics of repair of DNA strand breaks in irradiated cervical cancer cell lines. Cancer Res. 2004;64:7144–9. doi: 10.1158/0008-5472.CAN-04-1433. [DOI] [PubMed] [Google Scholar]
- 27.Lee Y, Wang Q, Shuryak I, et al. Development of a high-throughput γ-H2AX assay based on imaging flow cytometry. Radiat Oncol. 2019;14:1–10. doi: 10.1186/s13014-019-1344-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Bian L, Meng Y, Zhang M, et al. ATM Expression Is Elevated in Established Radiation-Resistant Breast Cancer Cells and Improves DNA Repair Efficiency. Int J Biol Sci. 2020;16:1096–106. doi: 10.7150/ijbs.41246. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Chandrakesan P, May R, Weygant N, et al. Intestinal tuft cells regulate the ATM mediated DNA Damage response via Dclk1 dependent mechanism for crypt restitution following radiation injury. Sci Rep. 2016;6 doi: 10.1038/srep37667. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Bernhard EJ, Maity A, Muschel RJ, et al. Effects of ionizing radiation on cell cycle progression. A review. Radiat Environ Biophys. 1995;34:79–83. doi: 10.1007/BF01275210. [DOI] [PubMed] [Google Scholar]
- 31.Pawlik TM, Keyomarsi K. Role of cell cycle in mediating sensitivity to radiotherapy. Int J Radiat Oncol Biol Phys. 2004;59:928–42. doi: 10.1016/j.ijrobp.2004.03.005. [DOI] [PubMed] [Google Scholar]
- 32.Levine AJ, Oren M. The first 30 years of p53: growing ever more complex. Nat Rev Cancer. 2009;9:749–58. doi: 10.1038/nrc2723. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Chuang JY, Tsai YY, Chen SC, et al. Induction of G0/G1 arrest and apoptosis by 3-hydroxycinnamic acid in human cervix epithelial carcinoma (HeLa) cells. In Vivo. 2005;19:683–8. [PubMed] [Google Scholar]
- 34.Murad H, Hawat M, Ekhtiar A, et al. Induction of G1-phase cell cycle arrest and apoptosis pathway in MDA-MB-231 human breast cancer cells by sulfated polysaccharide extracted from Laurencia papillosa. Cancer Cell Int. 2016;16:39. doi: 10.1186/s12935-016-0315-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Roche J, Erratum: Roche, J. The Epithelial-to-Mesenchymal Transition in Cancer. Cancers. Cancers (Basel) 2018:10. doi: 10.3390/cancers10020052. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Theys J, Jutten B, Habets R, et al. E-Cadherin loss associated with EMT promotes radioresistance in human tumor cells. Radiother Oncol. 2011;99:392–7. doi: 10.1016/j.radonc.2011.05.044. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Liu H, Wen T, Zhou Y, et al. DCLK1 Plays a Metastatic-Promoting Role in Human Breast Cancer Cells. Biomed Res Int. 2019;2019:1061979. doi: 10.1155/2019/1061979. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Ikezono Y, Koga H, Akiba J, et al. Pancreatic Neuroendocrine Tumors and EMT Behavior Are Driven by the CSC Marker DCLK1. Mol Cancer Res. 2017;15:744–52. doi: 10.1158/1541-7786.MCR-16-0285. [DOI] [PubMed] [Google Scholar]
- 39.Weidenfeld K, Barkan D. EMT and Stemness in Tumor Dormancy and Outgrowth: Are They Intertwined Processes? Front Oncol. 2018;8:381. doi: 10.3389/fonc.2018.00381. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Facchino S, Abdouh M, Chatoo W, et al. BMI1 confers radioresistance to normal and cancerous neural stem cells through recruitment of the DNA damage response machinery. J Neurosci. 2010;30:10096–111. doi: 10.1523/JNEUROSCI.1634-10.2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Zhao Y, Tao L, Yi J, et al. The Role of Canonical Wnt Signaling in Regulating Radioresistance. Cell Physiol Biochem. 2018;48:419–32. doi: 10.1159/000491774. [DOI] [PubMed] [Google Scholar]
- 42.Zhao Y, Yi J, Tao L, et al. Wnt signaling induces radioresistance through upregulating HMGB1 in esophageal squamous cell carcinoma. Cell Death Dis. 2018;9:433. doi: 10.1038/s41419-018-0466-4. [DOI] [PMC free article] [PubMed] [Google Scholar]





