. 2021 Jun 23;6(3):e00358-21. doi: 10.1128/mSphere.00358-21

TABLE 4.

Mutations within the VNTR region of related spa types

Patient	All clones^a	Related clones^b	Nonrelated^c	% of related clones^d	No. of isolates^e	spa type^f	VNTR region^g	Mutation(s)^h	Repeatⁱ	Nucleotide sequence of the repeat region^j
3	4	4	0	100	140	t008	11-19-12-21-17-34-24-34-22-25
					1	t13342	11-19-12-21-17-34-24-34-17-34	several
					1	t4816	11-19-12-21-17-24-34-22-25	del
					18	t024	11-12-21-17-34-24-34-22-25	del
4	6	4	2	67	123	t5430	04-44-33-31-12-16-34-16-34-16-12-25-22-22-34
					14	t16051	04-33-31-12-16-34-16-34-16-12-25-22-22-34	del
					10	t17174	04-44-33-31-12-16-34-16-34-16-12-16-12-25-22-22-34	dupl
					1	t16432	04-44-33-33-31-12-16-34-16-34-16-12-25-22-22-34	dupl
7	6	3	3	50	112	t206	11-19-12-12-12-21-17-34-24-34-22-25
					26	t211	11-19-12-12-21-17-34-24-34-22-25	del
					1	t2407	11-12-12-12-21-17-34-24-34-22-25	del
9	4	3	1	75	195	t002	26-23-17-34-17-20-17-12-17-16
					3	t062	26-23-17-12-17-16	del
					1	t3127	26-30-17-34-17-20-17-02-17-20-17-12-17-16	several
10	4	4	0	100	152	t617	15-21-16-02-24-24
					3	t15842	15-21-16-02-24-24-02-24-24	dupl
					4	t4401	15-21-16-02-24	del
					1	t930	15-16-02-24-24	del
11	2	2	0	100	197	t091	07-23-21-17-34-12-23-02-12-23
					3	t1204	07-23-21-23-02-12-23	del
12	5	4	1	80	74	t618	15-12-16-02-16-02-25-17-17-17-24
					1	t17076	15-12-16-02-16-02-24-17-17-17-24	pm	r24	AAAGAAGATGGCAACAAGCCTGGT
					1	t17077	15-12-16-02-16-17-25-17-17-17-24	several
					1	t17173	15-12-16-02-16-17-17-17-24-17-24	del and dupl
13	13	13	0	100	123	t003	26-17-20-17-12-17-17-16
					11	t045	26-17-20-17-12-17-16	del
					1	t15843	26-17-20-211-12-17-16	pm	r211	AAAGAAGACGGCAACAAGCCCGGT
					9	t264	26-17-20-17-17-17-16	del
					2	t439	26-17-20-17-17-16	del
					1	t5655	26-17-20-17-12-17-17-17	pm	r17	AAAGAAGACGGCAACAAGCCTGGT
					2	t16431	26-17-20-16-12-17-17-16	pm	r16	AAAGAAGACGGCAACAAACCTGGT
					2	t17075	26-17-12-17-12-12-17-17	several
					1	t463	26-17-17-16	del
					2	t564	26-17-17-17-16	del
					2	t959	26-17-02-17-12-17-17-16	pm	r02	AAAGAAGACAACAAAAAACCTGGC
					1	t7270	26-17-22-17-12-17-17-16	pm	r22	AAAGAAGACGGCAACAAGCCTGGC
					1	t17192	750-17-20-17-12-17-17-17	pm	r750	GGGGAAGACAACAAAAAACCTGGT
									r17	AAAGAAGACGGCAACAAGCCTGGT
14	5	2	3	40	102	t067	26-23-17-34-17-20-17-12-17
					12	t1399	26-23-17-12-17	del

All clones, all different spa types isolated from the airways of this patient.

Related clones, number of spa types, which evolved most likely due to mutational events in the variable number of tandem repeats (VNTR) of spa during persistence.

Nonrelated clones, number of additional clones with spa types characterized by a nonrelated repeat region of spa.

% of related clones, percentage of isolates with related spa types.

Number of isolates with the respective spa type.

spa type, the different spa types of patients with related spa types; ancestor strains are indicated in bold type.

VNTR region, the sequence of the repeats within the VNTR region. The mutated repeats are indicated in bold type in the ancestor strain.

Mutations, the mutational event that caused the changed repeat succession: del, deletion; pm, point mutation; dupl, duplication; several, several events (several different mutations occurred in the VNTR region, including pm, del, and dupl).

ⁱ

Repeat, the number of repeat, which shows a point mutation, which leads to a different repeat number and to a different spa type.

Nucleotide sequence, the changed nucleotide sequence of the repeat caused by one point mutation.