Table 1.
Overview of conditions, associated features, common presenting features and genetic variants identified
| Gene (inheritance) | Potential associated features | N | Pathogenic variants (n) | Refs.a |
|---|---|---|---|---|
| MC2R (AR) | Possible tall stature, hyperpigmentation | 30 | p.S74I (20); p.S74I/p.R128C; p.S74I/p.L224R; p.N81Kfs*3; p.D107N (3); p.R146H; p.R146H/p.V187Afs*29 (2); p.I154fs*248 | [14-18] |
| NR0B1 (X-linked) | Hypogonadotropic hypogonadism, infertility, possible early puberty | 12 | NR0B1 deletion (3); contiguous gene deletion b (2); p.W171*; p.L262Q; T265R; p.Y399*; p.H419Dfs*7 (2);p.F448S | [20-22,59] |
| CYP11A1 (AR) | Possible gonadal steroid insufficiency | 12 | p.R120Q/p.Q395K; p.R120*/c.940G > A (2); c.426-2A > G/c.940G > A; c.790-802del/c.940G > A (3); p.A277Dfs*11/c.940G > A; p.I279Yfs*10/c.940G > A; p.S391 = /c.940G > A; p.R424*/c.940G > A; p.R451W | [9,11,25] |
| AAAS (AR) | Triple A syndrome (alacrima, achalasia, neurological features, dermatological features) | 11 | p.S382Rfs*33/p.W474*; p.H71Ifs*23/p.R230* (2); p.R286*/ c.525_545 + 4dupCCGTGTGTATAATGCCAGCAGGTGT ; p.R286*/p.R478*; p.Q145*/p.S263P; p.R230*/p.Q456*; p.G14Vfs*45 (2); c.689 + 1G > C (2) | [60-62] |
| NNT (AR) | Possible early puberty | 10 | p.R71*; p.Y201Kfs*1 (2); c.599 + 2T > C; p.G255E (2); p.G664R/p.T689Lfs*32 (2); p.G678R; p.L977P | [28,29] |
| MRAP (AR) | Hyperpigmentation | 7 | p.M1? (2); p.E28K/c.106 + 2dupT; c.106 + 2dupT (2); c.106 + 1G > C (2) | [31] |
| TXNRD2 (AD) | Cardiac defects | 7 | p.Y447* (7) | [33] |
| STAR (AR) | Possible gonadal steroid insufficiency | 6 | p.A10T; p.V187M; p.G201D/p.G221S (2); p.G221D; p.T223Lfs*98 | [35,37,38] |
| SAMD9 c (AD/de novo) | MIRAGE syndrome (myelodysplasia, infection, restriction of growth, adrenal hypoplasia, genital phenotypes, enteropathy) | 5 | p.R459Q; p.R982C; p.R982H; p.R1293Q; p.K1569N | [39] |
| CDKN1C (AD, imprinted) | IMAGe syndrome (intrauterine growth restriction, metaphyseal dysplasia, adrenal hypoplasia, genitourinary anomalies) | 2 | p.D274N; p.K278E | [40] |
| NR5A1 (AD/de novo) | Gonadal dysgenesis/steroid insufficiency | 1 | p.G35E | [41] |
Italics indicates heterozygous (monoallelic) changes either as a dominant or compound heterozygous condition; bold indicates novel changes not reported previously by our groups or others; numbers in parentheses show the total number of individuals with this specific variant.
Abbreviations: AD, autosomal dominant; AR, autosomal recessive.
a References indicate our previous reports including these findings or other groups’ reports of these genetic variants (see supplementary table in [13]).
b One girl with a Xp21 contiguous gene deletion syndrome expressed a phenotype due to skewed X-inactivation.
c For SAMD9 the primary genetic change is shown, although several children had developed somatic revertant events such as monosomy 7 or second loss-of-function variants in SAMD9.