Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (M. musculus, male, female) | Kras | The Jackson Laboratory | RRID:IMSR_JAX:008179 |
KrasLSL-
G12D/WT |
| Strain, strain background (M. musculus, male, female) | KP (Kras p53) |
The Jackson Laboratory | RRID:IMSR_JAX:008462 |
KrasLSL-G12D/WT
Trp53Flox/Flox K and P interbred at Fred Hutch |
| Cell line (human) | A549 | ATCC | CCL-185 RRID:CVCL_0023 | Lung epithelial |
| Cell line (human) | NCI-H23 | ATCC | CRL-5800 RRID:CVCL_1547 | Lung adeno- carcinoma, epithelial |
| Cell line (human) | NCI-H2291 | ATCC | CRL-5939 RRID:CVCL_1546 | Lung adeno- carcinoma, epithelial |
| Cell line (human) | LOU-NH-91 | Kind gift from Montse Sanchez- Cespedes | RRID:CVCL_2104 | Lung squamous cell carcinoma |
| Cell line (human) | 91T | Kind gift From McGarry Houghton | Reference: Stabile et al. 2002 | Non-small cell lung cancer |
| Cell line (human) | NCI-H1975 | ATCC | CRL-5908 RRID:CVCL_1511 | Lung adeno- carcinoma, epithelial |
| Cell line (human) | DLD-1 | ATCC | CCL-221 RRID:CVCL_0248 | Colorectal adeno- carcinoma, epithelial |
| Recombinant DNA reagent (human) | pcDNA3-FLAG- His-MGA | Yuzuru Shiio | Plasmid to express full length MGA isoform2 Available from the Eisenman Lab |
|
| Recombinant DNA reagent (human) | pCDH-FLAG-His- MGA | This paper | Lentiviral construct to express full-length MGA Available from the Eisenman Lab |
|
| Recombinant DNA reagent (human) | pCDH-FLAG-His- MGAΔDUF | This paper | Lentiviral construct to express MGA lacking the aa1003- 1304 Available from the Eisenman Lab |
|
| Recombinant DNA reagent (M. musculus) | LentiCRISPRv2Cre | Addgene (Gift from Feldser lab) | ||
| Recombinant DNA reagent (M. musculus) | LentiCRISPRv2Cre sgMga1 | This paper | Insert (sgMga1 gRNA sequence): TAAGTGGAATGGTCGTTGGT | Lentiviral construct to transfect and express sgRNA Available from the Eisenman Lab |
| Recombinant DNA reagent (M. musculus) | LentiCRISPRv2Cre sgMga3 | This paper | Insert (sgMga3 gRNA sequence): TCAGAATTTTCAATATACGC | Lentiviral vector to express sgRNA Available from Eisenman Lab |
| Recombinant DNA reagent (human) | lentiCRISPRv2 PURO | Addgene (Gift from Feng Zhang) | Lentiviral vector to express sgRNA | |
| Recombinant DNA reagent (human) | lentiCRISPRv2 sgMGA | This paper | Insert (sgMGA gRNA sequence): CTATGCATCGTTACCTGC CG | Lentiviral vector to express sgRNA Available from the Eisenman Lab |
| Recombinant DNA reagent (human) | lentiCRISPRv2 sgPCGF6 | This paper | Insert (sgPCGF6 gRNA sequence): GGTATGAAGACATTCTGTGA | Lentiviral vector to express sgRNA Available from the Eisenman Lab |
| Recombinant DNA reagent (human) | lentiCRISPRv2 sgL3MBTL2.1 | This paper | Insert (sgL3MBTL2.1 gRNA sequence): CCGGAGTTATAACAGCAGTG | Lentiviral vector sgRNA Available from the Eisenman Lab |
| Recombinant DNA reagent (Mus musculus) |
LentiCRISPRv2sgL3mbtl2 | This Paper | Insert (sgL3mbtl2 gRNA sequence): CCGGAGTTACAACAGCAGTG | Lentiviral construct to transfect and express sgRNA Available from the Eisenman Lab |
| Recombinant DNA reagent (Mus musculus) |
LentiCRISPRv2sgPcgf6 | This Paper | Insert (sgPcgf6 gRNA sequence): GGTATGAAGACACTCTGTAA |
Lentiviral construct to transfect and express sgRNA Available from the Eisenman Lab |
| Recombinant DNA reagent (Mus musculus) |
LentiCRISPRv2sgMyc | This Paper | Insert (sgMyc gRNA sequence): TGTCCCCGAGCCGCCGCTC | Lentiviral construct to transfect and express sgRNA Available from the Eisenman Lab |
| Recombinant DNA reagent (human) | lentiCRISPRv2 sgL3MBTL2.1 | This paper | Insert (sgL3MBTL2.2 gRNA sequence): TTCACTTGACTCCTCCAGAT | Lentiviral vector to express sgRNA |
| Recombinant DNA reagent (human) | pLKO non-silence | SIGMA Mission shRNA |
Lentiviral vector to express shRNA | |
| Recombinant DNA reagent (human) | pLKO shMGA | SIGMA Mission shRNA |
TRCN0000237941 (ID RNAi consortium) |
Lentiviral vector to express shRNA |
| Antibody | MGA (rabbit, polyclonal) |
Novus Biological | Catalog no. NBP1-94031 | WB (1:500 in 3%BSA), IF (acetone fixation and 1:100) |
| Antibody | MGA (mouse, monoclonal) |
Developed at Fred Hutch | WB (1:500 in 5% milk) |
|
| Antibody | MGA (rabbit, polyclonal) |
Kind gift from Suske Lab (Univ. Marburg) | ChIP, CUT, and RUN (1:100) |
|
| Antibody | Ki67 (rabbit, polyclonal) |
Abcam | Catalog no. ab16667 | IF and IHC (1:200) |
| Antibody | MECA32 (mouse, monoclonal) |
DSHB | Catalog no. MECA-32-S | IHC (1:100) |
| Antibody | MYC (rabbit, polyclonal) |
Cell Signaling | Catalog no. 13987S | ChIP, CUT and RUN (1:200) |
| Antibody | MAX (rabbit, polyclonal) |
Proteintech | Catalog no. 10426–1-AP | WB (1:1000), ChIP, CUT and RUN |
| Antibody | L3MBTL2 (rabbit, polyclonal) |
Active Motif | Catalog no. 39569 | WB (1:1000), ChIP, CUT and RUN |
| Antibody | RNA polymerase II (all phosphoisomers) |
Active Motif | Catalog no. 39097 | ChIP (1:100) |
| Antibody | E2F6 (rabbit, polyclonal) |
Abcam | Catalog no. ab53061 | WB (1:1000), ChIP |
| Antibody | PCGF6 (rabbit, polyclonal) |
Proteintech | Catalog no. 24103–1-AP | WB (1:1000) |
| Antibody | Rabbit IgG | Cell Signaling | Catalog no. 2729 | ChIP |
| Antibody | GFP (rabbit, monoclonal) |
Cell Signaling | Catalog no. 2956S | CUT and RUN |
| Sequence-based reagent (human) | siSTAG3 | Qiagen | siRNA (Catalog no. SI00734440) |
|
| Sequence-based reagent (human) | siPODXL2 | Qiagen | siRNA (Catalog no. SI04142495) |
|
| Sequence-based reagent (human) | siMYC | Qiagen | siRNA (Catalog no./ID: 1027416) | FlexiTube GeneSolution GS4609 for MYC(human) |
| Sequence-based reagent (human) | siDeath | Qiagen | siRNA (Catalog no./ID: 1027299) | ALLSTARS HS Cell Death siRNA |
| Sequence-based reagent (human) | siCtrl/siCTRL | Qiagen | siRNA (Catalog no./ID: 1027281) | ALLSTARS Negative Control siRNA |
| Software | Biorender | Biorender.com | Used for illustrations |