TABLE 2.
Bacterial strains, plasmids, and primers used in this study.
| Strain name | Relevant characteristics | References |
| Escherichia coli DH5α | General cloning host, F-thi-1 endA1 hsdR17(r-,m-) supE44 _lacU169 (_80lacZ_M15) recA1 gyrA96 relA1 | StrataGene |
| E. coli MG1655 | Wild-type strain | ATCC 47076 |
| Bacillus methanolicus MGA3 | Wild-type strain | ATCC 53907 |
| Bacillus methanolicus M160-20 | 1st-generation S-(2-aminoethyl) cysteine-resistant mutant of MGA3; L-lysine overproducer | Brautaset et al., 2010 |
| Rhodococcus qingshengii DSM45257 | Wild-type strain | DSM45257 |
| Paenarthrobacter aurescens DSM20116 | Wild-type strain | DSM20116 |
| Kocuria rosea DSM20447 | Wild-type strain | DSM20447 |
| Peribacillus simplex DSM1321 | Wild-type strain | DSM1321 |
| Pseudomonas putida KT2440 | Wild-type strain | DSM6125 |
| Genomic DNA | Relevant characteristics | References |
| Bacillus megaterium DSM32 | Wild-type strain | DSM32 |
| Plasmid | Relevant characteristics | References |
| pBV2xp | KanR; derivative of pHCMC04 for gene expression under control of the xylose-inducible promoter. | Drejer et al., 2020 |
| pTH1mp | CmR; derivative of pTH1mp-lysC for gene expression under control of the mdh promoter. The lysC gene was replaced with multiple cloning site. | Irla et al., 2016 |
| pMI2mp | CmR; Low copy number derivative (in E. coli) of pTH1mp | Drejer et al., 2020 |
| pBV2xp-davBAPp | KanR; pBV2xp derivative for expression of the P. putida davBA operon under control of the xylose-inducible promoter. | This study |
| pBV2xp-davBAWs | KanR; pBV2xp derivative for expression of the W. sterculiae davBA operon under control of the inducible xylose-inducible ose promoter. | This study |
| pBV2xp-davBARd | KanR; pBV2xp derivative for expression of the R. denitrificans davBA operon under control of the xylose-inducible promoter. | This study |
| pBV2xp-davBWs-davAPc | KanR; pBV2xp derivative for expression of the synthetic operon containing davB from W. sterculiae and davA from P. caldoxylosilyticus. Expression under control of the xylose-inducible promoter. | This study |
| pBV2xp-davAPc-davBRd | KanR; pBV2xp derivative for expression of the synthetic operon containing davA from P. caldoxylosilyticus and davB from R. denitrificans. Expression under control of the xylose-inducible promoter. | This study |
| pBV2xp-davBPp | KanR; pBV2xp derivative for expression of the P. putida davB gene under control of the xylose-inducible promoter. | This study |
| pBV2xp-davBWs | KanR; pBV2xp derivative for expression of the W. sterculiae davB gene under control of the xylose-inducible promoter. | This study |
| pMI2mp-davAPc | CmR; Derivative of pMI2mp for expression of P. caldoxylosilyticus davA gene under control of the constitutive mdh promoter. | This study |
| pMI2mp-davAPp | CmR; Derivative of pMI2mp for expression of P. putida davA gene under control of the constitutive mdh promoter. | This study |
| pBV2xp-raiPPs | KanR; pBV2xp-derived expression of raiP gene from P. simplex, under control of the xylose-inducible promoter | This study |
| pBV2xp-raiPSj | KanR; pBV2xp-derived expression of codon-optimized raiP gene from S. japonicus, under control of the xylose-inducible promoter | This study |
| pBV2xp-raiPTv | KanR; pBV2xp-derived expression of codon-optimized raiP gene from T. viride, under control of the xylose-inducible promoter | This study |
| pTH1mp-cadA | CmR; Derivative of pTH1mp for expression of E. coli MG1655-derived cadA gene under control of the constitutive mdh promoter. | Nærdal et al., 2015 |
| pTH1mp-katA | CmR; Derivative of pTH1mp for expression of B. methanolicus-derived katA gene under control of the constitutive mdh promoter. | This study |
| pBV2xp-AVAEc | KanR; pBV2xp derivative for expression of the E. coli MG1655-derived genes patDA under control of the xylose-inducible promoter. | This study |
| pBV2xp-AVABm | KanR; pBV2xp derivative for expression of the B. megaterium DSM32-derived genes patDA under control of the xylose-inducible promoter. | This study |
| pBV2xp-AVAPp | KanR; pBV2xp derivative for expression of P. putida KT2440-derived spuI, spuC, kauB, and pauD2 genes under control of the xylose-inducible promoter. | This study |
| pBV2xp-AVARq | KanR; pBV2xp derivative for expression of the R. qingshengii DSM45257-derived puo and E. coli MG1655-derived patD genes under control of the xylose-inducible promoter. | This study |
| pBV2xp-AVAPa | KanR; pBV2xp derivative for expression of the P. aurescens DSM20116-derived puo and E. coli MG1655-derived patD genes under control of the xylose-inducible promoter. | This study |
| pBV2xp-AVAKr | KanR; pBV2xp derivative for expression of the K. rosea DSM20447-derived puo and E. coli MG1655-derived patD genes under control of the xylose-inducible promoter. | This study |
| Primer | Sequence 5′ → 3′ | Characteristics |
| davBA_Pp_F1 | atagttgatggataaacttgttcacttaaggaggtagtacatatgaacaagaagaaccgcc | davBA from P. putida; fw |
| davBA_Pp_R1 | aacgacggccagtgaattcgagctcactagttatcagcctttacgcaggtg | davBA from P. putida; rv |
| davB_Pp_F1 | gatggataaacttgttcacttaagg | davB from P. putida for pBV2xp-davBPp; fw |
| davB_Pp_R1 | acggccagtgaattcgagctcaatccgccagggcgatc | davB from P. putida for pBV2xp-davBPp; rv |
| davA_Pc_F1 | ccagattagcatttaaactagttttgtaaacaattacataaataggaggtagtacatatggaaacatcatatgaaattgcac | davA from P. caldoxylosilyticus for pMI2mp-davAPc; fw |
| davA_Pc_R1 | tctagacctatggcgggtaccttaataaacatctgttcttctttcattcatc | davA from P. caldoxylosilyticus for pMI2mp-davAPc; rv |
| davB_Ws_F1 | ggataaacttgttcacttaaggaggtagtacatatgagagttacaacatcagttgg | davB from W. sterculiae for pBV2xp-davBWs; fw |
| davB_Ws_R1 | acggccagtgaattcgagctcttataatccaatatcaagtggtcc | davB from W. sterculiae for pBV2xp-davBWs; rv |
| davA_Pp_F1 | ccagattagcatttaaactagttttgtaaacaattacataaataggaggtagtacatatgcgcatcgctctgtacc | dava from P. putida for pMI2mp-davaPp; fw |
| davA_Pp_R1 | tctagacctatggcgggtacctcagcctttacgcaggtgc | dava from P. putida for pMI2mp-davaPp; rv |
| raippsfw | cttgttcacttaagggggaaatggctatgctcgctgtgatcagaaatggccttgg | raiP from P. simplex fw |
| raippsrv | gccagtgaattcgagctcatggtacggatcttaaaaaggctcactcaatgttctaggc | raiP from P. simplex rv |
| raipsjfw | cttgttcacttaagggggaaatggctatggaacatttagcagattgtttagaag | raiP from S. japonicus fw |
| raipsjrv | gccagtgaattcgagctcatggtacggatcttataattcatcttttgtatgttcaattg | raiP from S. japonicus rv |
| raiptvfw | cttgttcacttaagggggaaatggctatggataatgttgattttgcagaatctg | raiP from T. viride fw |
| raiptvrv | gccagtgaattcgagctcatggtacggatcttaaattttaacttgatattcttttgg | raiP from P. viride rv |
| Katafw | gtaaacaattacataaataggaggtagtagtacatgaccacaaataagaaaaaacttactacaagc | katA from B. methanolicus fw |
| katarv | ggatccccgggaattcaagctttaaacatgttaaactttcttttgtacaggtaaacctagac | katA from B. methanolicus rv |
| AVA1 | ttcacttaagggggaaatggcaaatggatcgtacagtcgttaaaa | patDA from B. megaterium; fw |
| AVA2 | acgacggccagtgaattcgagctttattggtggttcagctcatt | patDA from B. megaterium; fw |
| AVA3 | ttcacttaagggggaaatggcaaatgtcggtacccccgcgtgccgttcagcttaac | spuI from P. putida; fw |
| AVA4 | ttacacggtatgcaggtaccag | spuI from P. putida; rv |
| AVA5 | tggtacctgcataccgtgtaatacataaataggaggtagtaagaatgagcgtcaacaacccgcaaacccgtgaatg | spuC from P. putida; fw |
| AVA6 | ttattgaatcgcctcaagggtcaggtccag | spuC from P. putida; rv |
| AVA7 | acccttgaggcgattcaataatacataaataggaggtagtaagaatgaccaccctgacccgtgcggactgggaacaa | kauB from P. putida; fw |
| AVA8 | ttacagcttgatccaggtcgccttcagctcgg | kauB from P. putida; rv |
| AVA9 | cgacctggatcaagctgtaatacataaataggaggtagtaagaatgtcgttacgcatctgcatcc | pauD2 from P. putida; fw |
| AVA10 | acgacggccagtgaattcgagctttacgcggcgctgtcgccggcctttga | pauD2 from P. putida; rv |
| AVA11 | ttcacttaagggggaaatggcaaatgcaacataagttactgattaacggagaactggttag | patD from E. coli; fw |
| AVA12 | ttaatgtttaaccatgacgtggcggacga | patD from E. coli; rv |
| AVA13 | cacgtcatggttaaacattaatacataaataggaggtagtaagaatgaacaggttaccttcgagcgcatcggctttag | patA from E. coli; fw |
| AVA14 | acgacggccagtgaattcgagctttacgcttcttcgacacttactcgcatgg | patA from E. coli; rv |
| AVA23 | ttcacttaagggggaaatggcaaatgaacctaattcattttagtgtgaagg | puo from Kocuria rosea; fw |
| AVA29 | tcttactacctcctatttatgtaattgtttactcatcgctccgcgcccgtca | puo from Kocuria rosea; rw |
| AVA25 | ttcacttaagggggaaatggcaaatgcagaatcttgatcgcgacgttgtgatcgtcgg | puo from P. aurescens; fw |
| AVA30 | tcttactacctcctatttatgtaattgtttactcaggcgacaggtacagaagccaacttgtt | puo from P. aurescens; rv |
| AVA27 | ttcacttaagggggaaatggcaaatgcctactctccagagagacgttgcaatcgt | puo from R. qingshengii; fw |
| AVA31 | tcttactacctcctatttatgtaattgtttactcaggccttgctgcgagcgatgatgt | puo from R. qingshengii; rv |
| AVA32 | gtaaacaattacataaataggaggtagtaagaatgcaacataagttactgattaacggagaactggttag | patD from E. coli (for puo-patD); fw |
| AVA33 | acgacggccagtgaattcgagctttaatgtttaaccatgacgtggcggacga | patD from E. coli (for puo-patD); rv |
| MI09 | gataccaaatactgtccttctagtgtagccg | SDM of ori pUC9; fw |
| MI10 | cggctacactagaaggacagtatttggtatc | SDM of ori pUC9; rv |
CmR, chloramphenicol resistance; KanR, kanamycin resistance.