Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Sequence of MassARRAY primer relative to amplicon-cg02522757 and amplicon-cg13556224.
| Amplicons | Primer | Sequence (5′ -> 3′) |
|---|---|---|
| amplicon-cg02522757 | 10F | aaatccaatcctctcttaccaaaa |
| T7R | ttttaatttgtgggattaggttgag | |
| amplicon-cg13556224 | 10F | tttcaccttatccctctaaaccata |
| T7R | tattttttgagatttggaattgtgg |
