| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| CD19 BV785, Clone 6D5 | Biolegend | Cat# 115543; RRID: AB_11218994 |
| CD3 BV605, Clone 17A2 | Biolegend | Cat# 100237; RRID: AB_2562039 |
| CD4 BV711, Clone RM4-5 | Biolegend | Cat# 100550; RRID: AB_2562099 |
| CD8a BUV805, Clone 53-6.7 | BD Biosciences | Cat#; 564920 RRID: AB_2716856 |
| MHC-II APC-Cy7, Clone M5/114.15.2 | Biolegend | Cat# 107628 RRID: AB_2069377 |
| Ly6G Alexa Fluor 700, Clone 1A8 | Biolegend | Cat# 127622 RRID: AB_10643269 |
| EpCAM FITC, Clone G8.8 | Biolegend | Cat# 118208 RRID: AB_1134107 |
| CCR9 PE-Cy7, Clone CW-1.2 | Biolegend | Cat# 128712 RRID: AB_10933082 |
| CD11b BV605, Clone M1/70 | Biolegend | Cat# 101257; RRID: AB_2565431 |
| CD11c FITC, Clone N418 | Biolegend | Cat# 117306; RRID: AB_313775 |
| CD45 BUV737, Clone 104 | BD Biosciences | Cat# 564880 RRID: AB_2738998 |
| LPAM-1 PE, Clone DATK32 | BD Biosciences | Cat# 553811 RRID: AB_395066 |
| IL-10R PE, Clone 1B1.3a | BD Biosciences | Cat# 112706 RRID: AB_313519 |
| Ly6C PE-Cy7, Clone HK1.4 | ThermoFisher Scientific | Cat# 25-5932-82 RRID: AB_2573503 |
| F4/80 APC, Clone BM8 | ThermoFisher Scientific | Cat# 17-4801-82: RRID: AB_2784648 |
| IFNγ APC, Clone XMG1.2 | BD Biosciences | Cat# 17-7311-82: RRID: AB_469504 |
| IL-10 PE, Clone JES5-16E3 | Biolegend | Cat# 505008; RRID: AB_315362 |
| Il-17 eFluor 450, Clone eBio17B7 | ThermoFisher Scientific | Cat# 48-7177-82 RRID: AB_11149503 |
| CCR9 Alexa Fluor 647, Clone BLICCR9 | Biolegend | Cat# 346301 RRID: AB_2275427 |
| Rabbit anti-mouse ZO-1 | Abcam | Cat# ab216880; RRID: AB_10678863 |
| Rabbit polyclonal anti-MUC2 | Abcam | Cat# ab76774 RRID: AB_1523987 |
| Goat anti-rabbit IgG Alexa Fluore 555 | ThermoFisher Scientific | Cat# A32732 RRID: AB_2633281 |
| Donkey anti-rabbit IgG Alexa Fluor 488 | ThermoFisher Scientific | Cat# A32790 RRID: AB_2762833 |
| Chemicals, peptides, and recombinant proteins | ||
| Methylated bovine serum albumin (mBSA) | Sigma Aldrich | Cat# A1009 |
| Immunisation Grade Bovine Type II Collagen | Chondrex | Cat# 20021 |
| Incomplete Freund’s adjuvant (IFA) | Sigma Aldrich | Cat# F5506 |
| Phorbol-12-myristate-13 acetate (PMA) | Sigma Aldrich | Cat# P8139 |
| Ionomycin | Sigma Aldrich | Cat# I0634 |
| DAPI | Sigma Aldrich | Cat# D9542 |
| Brefeldin A | Biolegend | Cat# 420601 |
| 2-Mercaptoethanol | ThermoFisher Scientific | Cat# 31350010 |
| RNase-Free DNase set | QIAGEN | Cat# 79254 |
| Neomycin | Sigma Aldrich | Cat# N1876 |
| Metronidazole | Sigma Aldrich | Cat# M3761 |
| Vancomycin | Sigma Aldrich | Cat# V2002 |
| Ampicillin | Sigma Aldrich | Cat# A9393 |
| FITC-dextran | Sigma Aldrich | Cat# 46944-500MG-F |
| Collagenase VIII | Sigma Aldrich | Cat# C2139 |
| Collagenase V | Sigma Aldrich | Cat# C9263 |
| Collagenase D | Roche Diagnostics | Cat# 11088866001 |
| Dispase | GIBCO | Cat# 17105-041 |
| DNase I | Roche Diagnostics | Cat# 10104159001 |
| Liberase TL | Roche Diagnostics | Cat# 5401020001 |
| GlutaMAX | ThermoFisher Scientific | Cat# 35050061 |
| N-2 | ThermoFisher Scientific | Cat# 17502048 |
| B27 | ThermoFisher Scientific | Cat# 17504044 |
| N-acetylcysteine | Sigma Aldrich | Cat# A9165 |
| Murine epithelial growth factor | Peprotech | Cat# 315-09 |
| Human recombinant R-spondin | Biolegend | Cat# 783604 |
| Murine recombinant Noggin | Peprotech | Cat# 250-38 |
| Recombinant murine IFNγ | Biolegend | Cat# 575306 |
| Recombinant murine IL-10 | Biolegend | Cat# 575806 |
| Vercirnon (anti-CCR9) | Chemocentryx/MedChemExpress | Cat# HY-15724 |
| Critical commercial assays | ||
| Picopure™ RNA isolation kit | ThermoFisher Scientific | Cat# KIT0204 |
| iScript™ cDNA synthesis kit | Biorad | Cat# 1708891 |
| iQ™ SYBR® green supermix | Biorad | Cat# 1708882 |
| Nextera DNA library preparation kit | Illumina | Cat# FC-121-1030 |
| MinElute PCR purification kit | QIAGEN | Cat# 28004 |
| QIAamp DNA Mini Kit | QIAGEN | Cat# 51304 |
| BioPulverizer Lysing Matrix E | MP Biomedical Europe | Cat# 116914050 |
| Taq PCR Core kit | QIAGEN | Cat# 201225 |
| ZymoBIOMICS Microbial Community DNA Standard | Zymo Research | Cat# D6305 |
| Agencourt AMPure XP | Beckman Coulter | Cat# A63881 |
| Qubit dsDNA HS Assay Kit-500 assays | ThermoFisher Scientific | Cat# Q32854 |
| NEBNext Library Quant Kit for Illumina | New England BioLabs | Cat# E7630L |
| High Sensitivity D1000 ScreenTape | Agilent | Cat# 5067-5584 |
| Agilent High Sensitivity DNA Reagents | Agilent | Cat# 5067-4627 |
| MiSeq Reagent Kit v2 (500-cycles) | Illumina | Cat# MS-102-2003 |
| PhiX Control v3 | Illumina | Cat# FC-110-3001 |
| Human LPS-binding protein ELISA kit | R&D Systems | Cat# DY870-05 |
| Human intestinal fatty acid binding protein (I-FABP) ELISA kit | Sigma Aldrich | Cat# RAB0537 |
| Human LPS ELISA kit | Cusabio | Cat# CSB-E09945h |
| Murine LPS-binding protein ELISA kit | Hycult Biotech | Cat# HK205-01 |
| PAS staining kit | Abcam | Ab150680 |
| Deposited data | ||
| 16S DATA | This paper | NCBI SRA accession number PRJNA720523 |
| Experimental models: Organisms/strains | ||
| Mouse, C57BL/6J | Envigo | N/A |
| Mouse, NOD.Cg-PrkdcscidIl2rgtm1Wjl/Szj (NSG) | UCL, Clare Hall | N/A |
| Mouse, Tg(TcraR28,TcrbR28)KRNDim | Prof. Diane Mathis | N/A |
| Mouse, NOD I-Ag7 | Prof. Mauro Peretti | N/A |
| Mouse, Il10ra−/− | Prof. Werner Muller | N/A |
| Mouse, B6;129S5-Cldn8tm1Lex/Mmucd | Prof. Andrew Smith | N/A |
| Oligonucleotides | ||
| qPCR primers | ||
| Hprt | ||
| Fwd 5′– TTTGCTGACCTGCTGGATTAC −3′ | ThermoFisher Scientific, This paper | N/A |
| Rev 5′- CTTTTATGTCCCCCGTTGACT −3′ | ||
| V3/V4 16 s | ||
| Fwd 5′–TCCTACGGGAGGCAGCAGT-3′ | ThermoFisher Scientific, This paper | N/A |
| Rev 5′-GGACTACCAGGGTATCTAATCCTGTT-3′ | ||
| Il10ra | ||
| N/A | QIAGEN | Cat# 249900 |
| Software and algorithms | ||
| GraphPad Prism 8 | Graphpad Software | https://www.graphpad.com |
| Flowjo v10.5.0 | Flowjo, LLC | https://www.flowjo.com |
| NDP.view2 Viewing software | Hamamatsu | https://www.hamamatsu.com/eu/en/product/type/U12388-01/index.html |
| Illumina Casava 1.7 | Illumina | https://www.illumina.com |
| Mothur V1.35.13 | Schloss et al.66 | https://mothur.org/ |
| Phyloseq | https://joey711.github.io/phyloseq/ | |
| Other | ||
| RPMI-1640 media | Sigma Aldrich | Cat# R8758 |
| Advanced DMEM/F12 | GIBCO | Cat# 12634028 |
| Red blood cell lysis buffer | Sigma Aldrich | Cat# R7757 |
| Foetal calf serum (FCS) | Biosera | Cat# FB1001/500 |
| Normal Goat Serum | Vector | Cat# S1000 |
| Ethylenediaminetetraacetic acid | ThermoFisher Scientific | Cat# AM9260G |
| LIVE/DEAD™ Fixable Blue | Invivogen | Cat# L34961 |
| Vectashield Mounting Medium with DAPI | Vector labs | Cat# H-1200-10 |
| Formalin solution, neutral buffered, 10% | Sigma Aldrich | Cat# HT501320 |
| Penicillin/Streptomycin | Sigma Aldrich | Cat# P0781 |
| eBioscience™ Intracellular fixation & permeabilisation buffer set | ThermoFisher Scientific | Cat# P078188-8824-00 |
| Brilliant stain buffer | BD Biosciences | Cat# 563794 |
| M. tuberculosis H37 Ra, desiccated | BD | Cat# 231141 |
| Percoll Plus | GE Healthcare | Cat# 17544501 |
| O.C.T compound | Tissue-Tek | Cat# 23-730-571 |
| Matrigel | Corning | Cat# 356231 |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.