The effect of single-nucleotide polymorphism in the promoter region of bovine alpha-lactalbumin (LALBA) gene on LALBA expression in milk cells and milk traits of cows

Abstract

Polymorphisms of milk protein genes have been proposed as candidate markers for dairy production traits in cattle. In the present study, a polymorphism was detected in the 5′-flanking (promoter) region of the bovine alpha-lactalbumin (LALBA) gene, a T/C transition located at nucleotide −1,001 relative to the transcription start site g.-1001T > C (NC_037332.1:g.31183170T > C), which is recognizable with PstI restriction endonuclease. In silico analyses showed that this mutation created novel retinoid X receptor alpha and vitamin D receptor transcription factor binding sites. Real-time PCR found that cows with different genetic variants of the promoter demonstrated different levels of expression of LALBA mRNA in milk somatic cells (MSCs). The TT genotype cows demonstrated low expression, whereas those with CT demonstrated much higher expression (P < 0.05). ELISA analysis found milk LALBA protein levels also differed between the TT and CT cows (P < 0.05) and that these levels were not correlated with the mRNA abundance in MSC. Association analysis found that the g.-1001T > C polymorphism in the promoter region of the LALBA gene influenced milk production traits in Polish Holstein-Friesian cows. High daily milk yield and dry matter yield, and high lactose yield and concentration were associated with the TT genotype. The TT genotype cows also had a lower number of somatic cells in the milk, considered as an indicator of udder health status. Therefore, the TT genotype could be more desirable from the breeder’s perspective.

Introduction

The genes coding for milk proteins (reviewed by Smaragdov et al., 2006; Caroli et al., 2009; Barłowska et al., 2012) and peptides (Brodowska et al., 2019), and their polymorphisms, are known candidate markers for dairy production traits in cattle. However, only a few studies have investigated the polymorphisms located in the 5′-flanking (promoter) regions of these genes. Because nucleotide substitutions in gene promoters may be located in cis-regulatory sequences, for example, in transcription factor (TF)-binding sites, they can influence the expression of the gene by increasing or decreasing the efficiency of its transcription. In addition, the polymorphisms located in 3′-untranslated regions (3′-UTRs) can also affect gene expression by changing binding of miRNAs. Such differences in expression levels can influence the physiological characteristics of animals, including their production traits.

The single-nucleotide polymorphisms (SNPs) located in promoter regions have been demonstrated to influence the TF binding capacity and expression of bovine caseins (Martin et al., 2002; Szymanowska et al., 2004) and bovine leptin (Adamowicz et al., 2006). The aim of the present study was to identify the nucleotide sequence polymorphisms in the potential regulatory regions of the bovine alpha-lactalbumin (LALBA) gene, that is, the 5′-flanking and the 3′-UTR regions; these regions being assumed to possibly influence the gene expression and dairy production traits of cows.

In cattle, the LALBA gene is located on chromosome 5 (BTA5q12-13); it has a length of 29,714 base pairs (bp) and consists of four exons. In addition to the functional gene, the bovine genome also contains a LALBA pseudogene, but this is devoid of the 5′-flanking regulatory sequences (Vilotte et al., 1993). LALBA is a milk whey protein essential for lactose biosynthesis in the mammary gland. It enhances the substrate affinity of beta-1,4-galactosyltransferase (B4GALT1), which catalyzes the formation of lactose from glucose and uridine diphosphate galactose (Brew and Hill, 1975). In turn, lactose is a major osmotic factor in milk and plays a critical role in regulating milk volume. LALBA has also been included in the group of acute phase proteins (APPs), and as LALBA concentration was shown to be lowered during infections, it has been further classified as a negative APP (Reczyńska et al., 2018a); positive APPs are whose expression increases in response to inflammation. Due to the prominent role of LALBA in milk synthesis, its gene is considered a valuable genetic marker for milk production traits in cattle and other ruminants. However, screening studies on European cattle breeds suggest that LALBA is rather monomorphic within the coding sequence of the gene, and there have been only a few reports of polymorphisms in the 5′ region of the bovine LALBA gene.

Bleck and Bremel (1993a) cloned and sequenced the 5′ region of the LALBA gene in the Holstein cattle and identified three SNPs at positions +15, +21, and +54 relative to the mRNA transcription starting point. Since the +15 and +21 variations occurred in the 5′-untranslated (5′-UTR) region, they might influence the expression of LALBA at the level of mRNA translation. Although polymorphism +15 has also been shown to be associated with milk production traits in Holstein cows (Bleck and Bremel, 1993b), no significant association was observed between the +15 polymorphism and milk performance traits in Chinese Holstein cows (Zhang et al., 2007). Similarly, although SNP g.15G > A has been associated with LALBA and lactose concentrations in milk (Lunden and Lindersson, 1998), other studies have found no significant association with milk production traits such as lactose content and milk yield; however, they also note a potential association with high LALBA content and relative amount of total casein in milk (Visker et al., 1998).

As contradictory results were obtained regarding the associations between the LALBA gene SNPs and production traits, these should be examine in further studies based on different populations. Our findings provide the first insight into the association between SNPs in the LALBA and somatic cell count (SCC); such relationships are extremely valuable in dairy cattle breeding—mastitis is still responsible for high economic losses. There is a great need to identify new functional mutations in the candidate genes to allow the use of molecular genetics in the selection and breeding of livestock, that is, in marker-assisted selection (MAS). Therefore, the aim of the present study was to identify novel polymorphisms in the 5′-flanking and in 3′-UTR regions of the bovine LALBA gene and determine their possible effect on milk production traits and on LALBA expression.

Materials and Methods

Animals used in the association and LALBA expression studies

The study was conducted over 2 yr on a herd of Polish Holstein-Friesian (HF) dairy cows, black and white variety, born and maintained at the Experimental Farm of the Institute of Genetics and Animal Breeding of the Polish Academy of Science (IGAB PAS). All experimental procedures involving the animals were conducted in accordance with arrangements of The Guiding Principles for the Care and Use of Research Animals and were approved by the Local Ethics Commission (permissions no. 3/2005, 84/2006, and 27/2009). Altogether, 212 cows were used; all animals were present on the farm during the 2 yr of the study. The cows were descendants of 68 sires and all were between their first and fourth lactations. Throughout the study, they were kept under identical conditions in a loose housing system with an outside run and with free access to water. They were fed the total mixed ration diet, consisting of corn silage (75%), concentrates (20%), and hay (5%), supplemented with a mineral and vitamin mixture, according to the National Institute for Agricultural Research (INRA) system requirements adopted by Research Institute of Animal Production (IZ PIB), Poland (Strzetelski and Śliwiński, 2009).

Search for LALBA gene polymorphism

Blood samples were collected by an authorized veterinarian from 30 HF cows randomly chosen from the flock of 212 cows. DNA was isolated from whole blood according to Kanai et al. (1994). The potential regulatory regions of the bovine LALBA gene, that is, the 5′-flanking region and in the 3′-UTR, were searched for polymorphisms. For this purpose, three pairs of primers were designed using Primer3 v. 0.4.0 (https://bioinfo.ut.ee/primer3-0.4.0/) program based on the bovine LALBA gene sequence (Acc. No. NC_037332.1_ARS-UCD1. 2, whole genome shotgun sequence). Overlapping fragments of the LALBA gene 5′ region (nt −1,080 to +54) NC_037332.1:g.31183091–g.31184224 and the 3′ region including 3′-UTR (nt +1,698 to +2,073) NC_037332.1:g.31185868–g.31186242 were amplified. The primer sequences, annealing temperatures, length of amplicons, and their positions in the LALBA gene are shown in Table 1.

Table 1.

PCR primers used for RFLP genotyping of the LALBA gene NC_037332.1

Primer symbol	Primer sequence 5′→3′	Length of amplicon, bp	Annealing temperature, °C	Position in the gene—relative to transcription start point (nt) and NC_037332.1
LALBAPF1 LALBAPR1	TTTAGTGGTATTGGTGGTTGG CAGGAGCAGAGAGACAAAGG	722	62	Promoter region (−668 to −1), g.31183503 to g.31184170 Exon 1 with 5′-UTR (1 to 54) g.31184171 to g.31184224
LALBAPF2 LALBAPR2	TGAGCAACTAAGCACAGCA CATCCCCAACCACCAATAC	438	61	Promoter region (−1,080 to -643) g.31183091 to g.31183528
LALBAUF1 LALBAUR1	GCCCATAAAGCACTCTGTTC TCACCCTATTTCCTCCCTCT	375	60	Exon 4 with 3′-UTR (1,698 to 2,022) g. 31185868 to g.31186192 3′flanking region (2,023 to 2,073) g.31186193 to g.31186242

The PCR products were purified with a GenElute PCR DNA Purification Kit (Sigma–Aldrich Corporation, St. Louis, MO) and directly sequenced in an ABI 377 sequencer (Applied Biosystems, Foster City, CA). The sequences were analyzed using Sequencher (Gene Codes Corporation, Ann Arbor, MI) software. Polymorphisms were detected by comparing DNA sequences with each other and with the Bos taurus reference genome sequence NC_037332.1_ARS-UCD1. 2, using the BLAST program (https://blast.ncbi.nlm.nih.gov/Blast.cgi).

Measuring LALBA gene expression in milk somatic cells by real-time PCR

For isolation of somatic cells, milk samples (1 liter) were collected from 30 dairy HF cows, that is, the same cows used for the detection of polymorphisms, all of which were around midlactation. Milk was centrifuged at 1,500 rpm for 30 min at 21 °C. The fat layer and the skimmed milk were discarded. The cell pellets were suspended in phosphate-buffered saline (PBS). The cells were washed three times in 20 mL of PBS and spun down at 1,100 rpm for 15 min at 4 °C. Finally, the cells were suspended in 1 mL of TRIzol reagent (Invitrogen, Carlsbad, CA) and stored at −80 °C until used for RNA and protein extraction. The same milk samples were used for both mRNA and protein extraction.

Total RNA was isolated from milk somatic cells (MSCs) with TRIzol Plus RNA Purification System (Invitrogen) according to the manufacturer’s instructions. The RNA samples were treated by RNase-free DNase I (Invitrogen) to remove any residual DNA contamination. The quantity and quality of RNA were estimated by Nanodrop (Nanodrop, Wilmington, NC) and 2100 Bioanalyzer (Agilent, Santa Clara, CA). Only those samples with an A₂₆₀/A₂₈₀ ratio between 1.8 and 2.0 and RIN 8.8 to 10 were analyzed further. Finally, 19 RNA isolates appeared to fulfill the criteria for integrity and purity. Five of them were found to have a TT genotype, 11 a CT genotype, and 3 a CC genotype. One microgram of RNA was reverse transcribed to cDNA using Transcriptor First Strand cDNA Synthesis kit (Roche, Basel, Switzerland) according to the procedure given by the manufacturer.

The relative mRNA levels of the TT, CT, and CC variants of the bovine LALBA gene g.-1001T > C (NC_037332.1:g.31183170T > C) in MSCs were measured using real-time qPCR and the SYBR Green system. Reverse transcription reactions, real-time PCR conditions, and measurements of amplification efficiency were carried out as described previously (Ostrowska et al., 2013) with minor modifications. The following PCR primers were used to measure LALBA gene expression: forward—5′-CTCTGCTCCTGGTAGGCATC-3′ and reverse—5′-ACAGACCCATTCAGGCAAAC-3′ (Bernier-Dodier, et al., 2011). Optimum PCR conditions were adapted experimentally to the LALBA gene and cDNA from MSCs.

Real-time PCR was performed in a LightCycler 96 (Roche) using the following PCR mix: 0.5 µL of 10 µM forward and reverse primers; 1.5 µL of PCR Grade water; 5 µL of the LightCycler 480 SYBR Green I; and 2.5 µL of cDNA used as a template. The RPS9 gene was used as a reference; it had previously been found to demonstrate the most stable expression in cow mammary gland and MSC (Bionaz and Loor, 2007) and was found to demonstrate stable expression in the conditions of the present experiment. The PCR profile was as follows: 95 °C for 10 min of initial denaturation, 40 cycles of 95 °C for 15 s; 58, 60, 61, or 62 °C (depending on the examined gene fragment) for 30 s; and 72 °C for 40 s. Standard curves were prepared, and the efficiency of each reaction was calculated. To prepare standards, cDNA was prepared based on pooled MSC RNA from 19 cows. The PCR products were analyzed by electrophoresis on a 1.5% agarose gel, and melting curve analysis was performed to check amplification specificity. Negative controls, that is, without cDNA, were also included.

The results were calculated using the mathematical formula for relative mRNA quantification in real-time PCR given by Pfaffl (2001). The results were subjected to statistical analysis using GraphPad Software Prism v6 (San Diego, CA). The effect of the genotype on transcript level was examined using an analysis of variance (ANOVA), with post hoc Bonferroni’s correction. The analysis and visualization of data was carried out in the R environment. The statistical analysis included the number of lactation. The number of animals in each gene variant was as follow: CC—5 cows, TT—11 cows, and CT—14 cows. Seven of cows were in their first lactation, 10 in second, eight in third and five in the fourth lactation.

Measuring LALBA concentration in milk (ELISA)

Thirty cows with different g.-1001T > C (NC_037332.1:g.31183170T > C) genotypes, i.e. the same animals that were used for the detection of polymorphisms, were tested for LALBA level in their MSC. LALBA protein was isolated from MSC with the TRIzol Plus RNA Purification System (Invitrogen) according to the manufacturer’s instructions. In MSC, the LALBA concentration was detected by ELISA and measured as previously described (Reczyńska et al., 2018b) using a Sunrise microplate reader and the Magellan program (both from Tecan, Switzerland). The ELISA kit used to detect bovine LALBA was purchased from EIAab enterprise (Wuhan EIAab Science, Hubei, China).

Data were obtained as the mean values of two duplicate readings: these were taken at 450 nm for each standard, control and sample. A standard curve was generated, and a four parameter logistic curve-fit was performed to calculate the results. The concentration of LALBA protein in milk was shown in µg/mL. The effect of the genotype on the protein level was also examined using an ANOVA, verified by post hoc Bonferroni’s correction.

In silico analyses

The 5′-flanking region of the LALBA gene was analyzed for the presence of possible TF binding sites using TESS software (http://www.cbil.upenn.edu/cgi-bin/tess/tess) and Transfac 7.0 database (http://www.gene-regulation.com/cgi-bin/pub/databases/transfac/search.cgi). When analyzing data from the TESS program, only those factors that met the following criteria were taken into account: the binding coefficient to DNA—LA = 2 (maximum value 2), Lq = 1 (maximum value 1), Ld = 0 (the best value 0), and the logarithms from LA probability were higher than 14. CpG islands were also sought in the 5′-flanking region of the LALBA gene using UCSC Genome Browser (http://genome.ucsc.edu/). The transcription initiation site was determined based on the positions indicated for the LALBA gene in the bovine genomic sequence.

Association study

Blood samples were collected from 212 dairy HF cows, and all cows were genotyped for the LALBA gene g.-1001T > C SNP (NC_037332.1:g.31183170T > C) using restriction fragment length polymorphism (RFLP)—PstI. The gene polymorphism/milk trait association study was conducted as described previously (Dux et al., 2018). Altogether, 6,011 records on daily milking were gathered from the official control system of production traits from all 212 cows.

As pedigree information may increase the false-positive rate and result in an underestimation of quantitative trait locus (QTL) effect sizes (Ekine et al., 2014), a combination of variance analysis with a repeatability model based on test-day information was used to determine the influence of the LALBA genotype on the investigated milk traits. The MIXED procedure was applied with the Bonferroni correction using SAS package 9.4 [SAS/STAT 2002–2012]. The statistical model comprised the random effect of the animal and LALBA genotype, the year-season of calving (43 classes), the year-month of milking (120), parity (lactations 1 to 4 with class 4 included in lactation > third), and day-in-milk linear covariate modeled using Legendre polynomials nested within parity (Brotherstone et al., 2000) up to fifth power: these effects are all fixed. Four seasons of calving were formed: the first from December to February, the second from March to May, the third from June to August, and the fourth from September to November. The model used for the analysis of component content in milk also included the daily milk yield as a linear covariate. Prior to analysis, all traits were tested for normality of distribution, and SCC was transformed to natural logarithm values (the details are given in Supplementary File 1).

Results

One polymorphism was detected in the 5′-flanking (promoter) region of the bovine LALBA gene, this being a T/C transition located at nucleotide −1,001, relative to the transcription start site g.-1001T > C (NC_037332.1:g.31183170). It created a new digestion site for the PstI restriction endonuclease, allowing for PCR-RFLP. No CpG islands were detected in the promoter and no polymorphisms were detected in the region of the LALBA gene coding for the 3′-UTR of mRNA.

Effect of the LALBA g.-1001T > C polymorphism on gene expression

The expression level (i.e. mRNA abundance) of the LALBA gene in the MSCs of the tested cows, as determined by real-time PCR, is shown in Figure 1. The tested cows carried different genetic variants of the LALBA gene 5′-flanking region.

Figure 1.

Expression of the LALBA gene in milk somatic cells of HF cows with different g.-1001C > T (NC_037332.1:g.31183170T > C) genotypes: CC (n = 5), TT (n = 11), and CT (n = 14). The graph shows the mean expression values for individual genotypes with the ± SEM. *Significant difference was found between TT and CT genotypes at (P < 0.05). ln, natural logarithm transformation.

The TT genotype demonstrated different levels of LALBA expression to the CC and CT genotypes. The LALBA mRNA levels in MSC derived from CC and CT cows were roughly sevenfold and ninefold higher than in the homozygous TT variant, respectively. However, only the difference between the TT and CT LALBA variants was statistically significant (P < 0.05); no significant difference was observed between the TT and CC LALBA variants (P > 0.1).

Effect of LALBA g.-1001T > C polymorphism on the LALBA content in milk

LALBA protein levels in milk were found to differ between cows with TT and CT genotypes, as indicated by ELISA (Figure 2).

Figure 2.

Concentration of LALBA protein in milk of HF cows with different g.-1001C > T (NC_037332.1:g.31183170T > C) genotypes: CC (n = 5), TT (n = 11), and CT (n = 14), as measured by ELISA assays. The graph shows the means for individual genotypes with the ± SEM. *Significant difference was shown between genotypes TT and CT at (P < 0.05).

LALBA content was about 40% higher in the milk from the TT cows than from the CT cows (P < 0.05) and around 30% higher in the CC cows than the CT heterozygotes; however, this difference was not statistically significant.

In silico search for TF binding sites in LALBA gene promoter

To check whether the polymorphism found in the 5′-flanking region of the LALBA gene is located within or near potential TF binding sites, in silico analysis was conducted using TESS software and the Transfac 7.0 database. Potential binding sites for 25 TFs were identified in the analyzed 1,500-bp-long LALBA promoter region (not shown). A comparison of potential TF binding sites between the T and C alleles in the 60-bp 5′-flanking region of the bovine LALBA gene (nt −1,021 to −961), where the polymorphic g.-1001C > T site is located, found two TF binding sites, retinoid X receptor alpha (RXRA) and vitamin D receptor (VDR), to be located in allele C; the substitution C→T abolishes these sites.

Additionally, the possible presence of the CpG islands, these being preferential sites for DNA methylation and which could also affect the level of gene expression, was searched in the promoter region of the LALBA gene. However, none were detected in the examined 1,500-bp-long fragment of the gene (not shown).

Effect of LALBA g.-1001T > C polymorphism on milk production traits

Some differences between genotypes were revealed by the analysis of the relationship between the g.-1001T > C polymorphism with milk production traits (Table 2). The TT genotype was associated with high daily milk and dry matter, as well as lactose yields and concentration (%): these cows produced, on average, 0.9 kg of more milk per day, as well as about 0.3 kg more protein, 0.15 kg more lactose, and 0.09 kg more dry matter than the CT cows. They also had a significantly lower number of somatic cells in the milk compared with the CT cows (SCC), which is considered as an indicator of udder health status. The CT cows were characterized by a higher SCC than other genotypes. In addition, the milk from the TT cows showed a high protein yield comparable with that found in the CC cows.

Table 2.

Relationship between the polymorphism present in the 5′-flanking (promoter) region of the bovine LALBA gene (g.-1001T > C) with milk traits of Holstein-Friesian cows

Locus	SNP	n 1	N 2	Trait
				Milk yield, kg		Fat yield, kg		Fat percent		Protein yield, kg		Protein percent
				Mean	SE4	Mean	SE	Mean	SE	Mean	SE	Mean	SE
LALBA	CC	15	494	26.3	1.10	1.10	0.05	4.34	0.14	0.83A	0.03	3.48	0.06
	CT	92	2,639	25.6A	1.08	1.08	0.05	4.37a	0.13	0.79B	0.03	3.46	0.05
	TT	105	2,878	26.5B	1.09	1.09	0.05	4.28b	0.13	0.82A	0.03	3.44	0.05
				Lactose yield, kg		Lactose percent		lnSCC3		Dry matter yield, kg		Dry matter percent
LALBA	CC	15	494	1.22	0.16	4.64A	0.04	5.74A	0.20	3.39	0.12	13.22	0.16
	CT	92	2,639	1.19A	0.15	4.67A	0.04	6.06B	0.18	3.31A	0.12	13.22a	0.15
	TT	105	2,878	1.25B	0.15	4.70B	0.04	5.90A	0.19	3.40B	0.12	13.14b	0.15

¹ n, number of animals.

² N, number of records.

^a-clnSCC, transformation of somatic cell count into natural logarithm scale.

Within the columns, values with the same superscript are significantly different at P ≤ 0.05; ABC at P ≤ 0.01.

Discussion

Our findings indicate that the expression of LALBA mRNA in MSCs freshly isolated from cow milk differs according to the genotype of the cow, that is with regard to the g.-1001T > C polymorphism in the LALBA gene promoter (NC_037332.1:g.31183170T > C); low expression is observed in the TT cows, and much higher in CC and CT cows. We believe that these differences, analyzed in MSC, reflect the level of LALBA expression in the mammary gland.

The cells isolated from milk offer an attractive noninvasive alternative to udder biopsies for monitoring the mammary gland metabolism of dairy animals. RNA isolated from MSCs has previously been used to study the expression of the LALBA, B4GALT1, κ-casein, and BCL2-associated X, apoptosis regulator (BAX) genes in feed-restricted cows (Boutinaud et al., 2008), as well as in dairy goats (Reczyńska et al., 2018b; Pławińska-Czarnak et al., 2019). Milk cells were shown to accurately reflect the processes occurring at the mRNA level in the mammary gland of cows, for example genes engaged in lipogenesis (Murrieta et al., 2006). The expression levels of genes specific for mammary gland epithelial cells (CSN3 and LALBA) in MSC were found to have a significant positive correlation with those in udder tissue (Krappmann et al., 2012).

The variation observed in the expression of the LABA gene variants could be due to the location of the g.-1001T > C mutation within the potential RXRA and VDR TF binding sequences. The canonical TF binding sites were present only in variant (allele) C of the gene. Moreover, they are located very close to each other.

Early studies have shown that 1,25-(OH)2D3 associates with the VDR and promotes its heterodimerization with the retinoid X (RXR) receptor (Mangelsdorf and Evans, 1995). As the VDR–RXR heterodimer is the functionally active TF, the close location of the potential binding sites for VDR and RXR factors in the LALBA gene promoter may indicate that these could be a “functional” regulatory site that actually participates in the binding of the RXR–VDR complex and mediates the regulation of gene expression by vitamins D and A.

Studies have shown that the VDR ligand, 1,25-dihydroxyvitamin D, modulates key proteins involved in signaling proliferation, differentiation, and survival of normal mammary epithelial cells (Welsh, 2017). VDR has been also identified as one of the key regulators of mammary gland development during the pregnancy–lactation cycle in mice (Zhou et al., 2014).

The function of retinoic acid (RA), a VDR ligand, in the development and differentiation of the mammary gland under physiological conditions is not well characterized. It has been found, however, that inhibition of RA signaling in transgenic mice leads to excessive mammary ductal morphogenesis (Wang et al., 2005), and retinoids induced morphogenesis of alveoli-like structures in mammary epithelial cells in vitro in a 3D extracellular matrix (Montesano and Soulié, 2002). This activity was mediated through a RARα-dependent signaling pathway. Although there is no evidence of direct regulation of the expression of milk protein genes by vitamins D and A, sequences homologous to the VDRE TF and to the retinoic X receptor (RARE) have been observed in the rabbit β-casein gene promoter (Malewski and Zwierzchowski, 1995).

Bleck and Bremel (1993b) identified an SNP at position +15 which appears to be associated with milk production traits in Holstein cows. Cows with the genotype AA, that is with an A at position +15 in both alleles, had a higher milk yield, protein yield, and fat yield than those with genotype BB, that is with a G, C, or T nucleotide in both alleles. In turn, milk from the BB cows demonstrated a higher percentage of protein and fat. The authors propose that the +15 SNP in the LALBA gene may directly influence differences in milk production, and that this polymorphism may represent a QTL.

Voelker et al. (1997) report the presence of a novel sequence variation in the bovine LALBA gene 5′-flanking region: an A/G transition running from nt 1,689 up to the transcription starting point (g.-1689A > G). In this study, the A variants at two SNPs were always linked, suggesting the existence of an AA haplotype (+15A/–1,689A) associated with high milk, protein, and fat yields. The existence of the g.-1689A > G transition was confirmed in Polish HF cattle by Kaminski (1999) and recognized as a RFLP-SduI. Within and around this mutation, 30 potential TF binding sites were found, suggesting that it may influence the gene expression level. Elsewhere, Kaminski et al. (2002) report a significant relationship between the g.-1689A > G polymorphism and the Type Production Index and Predicted Transmitting Abilities of Polish Black-and-White bulls. Bojarojc-Nosowicz et al. (2005) also studied the influence of the g.-1689A > G polymorphism of the LALBA gene on infection with bovine leukemia virus (BLV) in Polish Black-and-White cattle; however, due to the low number of animals in some groups, the results could not be interpreted in terms of the relationship between the LALBA genotype and the occurrence of BLV infection.

In contrast to very large differences in LALBA gene mRNA expression observed in the MSC of cows differing in LALBA genotype, only small changes in LALBA protein concentration were revealed in the milk analysis. Moreover, no correlation was found between the expression of the LALBA gene in MSC, measured at the transcript level, and the content of the protein in milk. In fact, among the TT cows, the lowest level of LALBA mRNA in milk cells was associated with the highest level of LALBA protein in milk.

This result, although somewhat surprising, can be explained by the obviously different mechanisms of regulating LALBA expression at the level of transcription, translation, and secretion. It is well known that in most gene expression studies, the correlation between mRNA and protein levels is notoriously poor (Koussounadis et al., 2015). The discrepancy is typically attributed to the presence of different levels of regulation between transcript and protein product (Vogel and Marcotte, 2012), that is, posttranscriptional, translational, and degradative regulation processes, acting through mechanisms such as miRNAs. It is also possible that LALBA protein expression could be regulated epigenetically by miRNA: numerous miRNA binding sites have been identified in the 3′-UTR region of the bovine LALBA gene (Said Ahmed et al., 2017), but their functional role has not yet been studied.

Our results indicate that the g.-1001T > C polymorphism located in the promoter region of the LALBA gene influenced most milk production traits in HF cows, with the TT genotype demonstrating high daily milk yield and dry matter yield, and high lactose yield and concentration, but low SCC.

However, the genotype only appears to have a relatively small impact on milk production traits, and the differences between genotypes do not exceed a couple of percent. It must be remembered, however, that milk yield and milk composition are quantitative traits, determined by many genes and by hundreds or even thousands of different mutations located in these genes. Therefore, the effect of a single gene and single mutation may be small.

In addition, the TT variant of the LALBA gene is characterized by low expression in MSCs, lower than the CC variant, and therefore, presumably, also in the mammary gland itself. On the basis of the obtained results, however, it is difficult to speculate whether the polymorphism in the promoter region and the level of gene expression have a direct, causal relationship with milk production and composition. Based on our present findings, the g.-1001T > C polymorphism offers promise as a genetic marker, one of the many markers, rather than main gene, that can be used in the MAS of the cattle.

Until now, there have been few studies of polymorphism in the 5′-flanking region of the LALBA gene in cattle and in other ruminants. Visker et al. (2012) report the presence of four SNPs in the promoter region of the LALBA gene in different breeds of cows: g.-1290G > T, g.-1206C > A, g.-1000T > C, and g.-788G > T. In addition, two SNPs were identified in the 3′-UTR: g.1778T > C and 1857G > A. Kazmer et al. (2001) identified a novel SNP in the bovine LALBA gene with the presence of either C or G at position −1,691 (g.-1691G > C). In addition, a study of variation in the frequency of alleles at two polymorphisms in the LALBA gene (g.-1689A > G and g.+15A > G) in B. taurus (Holstein) and Bos indicus (Nellore) cows by Martins et al. (2008), identified a novel sequence variation at nt −46, designated as alleles A (an adenine) and B (a guanine). The frequencies of alleles differed between Holstein and Nellore breeds.

The g.-1000T > C (M90645) polymorphism studied by Visker et al. (2012) is the same as that investigated in the present study: g.-1001T > C (NC_037332.1:g.31183170). However, the present study used a different reference sequence (M90645 vs. NC_037332.1) to design primers and locate mutations; as such, position NC_037332.1:g.31183660 (as in the reference sequence NC_037332.1) includes an additional T nucleotide compared with M90645, and thus is described as g.-1001C > T. The frequency of the rarer allele (C) was 0.29 in our studies and 0.42 in Visker et al (2012). Nevertheless, to our knowledge, the “functionality” of any of the polymorphisms located in the LALBA gene 5′-flanking region, for example, their effect on gene expression or association with production traits, has not been previously studied in cattle. No other polymorphisms previously reported in the promoter region of the bovine LALBA were detected in our research; this could be due to low number of animals used for DNA sequencing (N = 30) combined with the low frequency of variant alleles in HF cattle.

Regarding other ruminant species, the nucleotide sequence changes identified in the promoter region of the LALBA gene were also found to be present in Sarda goats (Dettori et al., 2015). The three SNPs were also found to have an influence on milk yield and lactose content. Genotypes TT and CT at c.-358T > C and genotypes AG and GG at c.-163G > A were characterized by higher lactose contents, whereas c.-358CC and c.-163AA were associated with lower milk yield. SNPs c.-358T > C and c.-121T > G were located in TF binding sites, potentially involved in modulating LALBA gene expression.

In summary, our findings indicate that the polymorphism found in the 5′-flanking region of the bovine LALBA gene influenced the expression of the LALBA mRNA in MSC, and presumably also in the mammary gland of the studied cows. This result clearly indicates that the expression of the LALBA gene is allele dependent, with the expression of the C allele being much higher than that of the T allele. Allele-dependent gene expression is common in mammalian cells (Olbromski et al., 2013), and allelic expression imbalance, caused by allele-specific differences in cis or trans regulatory elements (Pastinen et al., 2006), is an important factor in phenotypic traits that can be heritable. We believe that the g.-1001T > C nucleotide substitution in the LALBA gene promoter, located within the binding sequence for RXR-α and VDR TFs, is just such a variable cis-regulating element conditioning allele-dependent expression. One hypothesis proposes that differences in the levels of gene expression are the main cause of the phenotypic diversity of individuals within a species. Therefore, finding genes with a skewed allelic ratio seems to be a helpful approach in the search of genetic factors that determine animal phenotypes. In farm animals, such allele-dependent expression could be the molecular basis for variation in production, for example in the dairy or beef performance of cattle, and the quality of animal products. Such approach allows a rational search for new markers of animal production traits.

Although our findings demonstrate that T→C nt substitution in the LALBA gene promoter influences the milk production traits of HF cows, they do not offer any evidence that the g.-1001T > C polymorphism directly influences the yield and composition of cow’s milk or that this is related to the differential expression of the LALBA gene.

The polymorphism in the 5′-flanking (promoter) region of the bovine LALBA gene (g.-1001T > C) NC_037332.1:g.31183170 influences the milk production traits of HF cows. This polymorphism can be treated as a marker of milk production traits of cattle when performing MAS. The g.-1001T > C polymorphism affects the expression of the gene in MSC on the transcript level; this may be related to changes in the binding of RXR-α and VDR TFs in the LALBA promoter caused by substitution of T→C nucleotides. However, the genotype-dependent changes in LALBA protein concentration observed in milk do not appear to correlate with the abundance of mRNA in MSC. It remains to be investigated whether a causal relationship exists between the level of LALBA expression caused by the mutation in the promoter region and the production phenotype of the cow.

Glossary

Abbreviations

APP

acute phase protein

BAX

BCL2 associated X apoptosis regulator

BLV

bovine leukemia virus

B4GALT1

beta-1,4-galactosyltransferase 1

LALBA

alpha-lactalbumin

MAS

marker-assisted selection

MSC

milk somatic cells

QTL

quantitative trait locus

RFLP

restriction fragment length polymorphism

RA

retinoic acid

RXR

retinoid X

RXRA

retinoid X receptor alpha

SCC

somatic cell count

SNP

single-nucleotide polymorphism

TMR

total mixed ration

VDR

vitamin D receptor

Funding

This research work was supported by grants 2012/05/B/NZ9/03425 (association analysis), 2014/13B/NZ9/02509 (transcriptomic study) from the National Science Center (NCN) of Poland. This study was also financially supported by the Leading National Research Centre Scientific Consortium’s “Healthy Animal – Safe Food” initiative under the Ministry of Science and Higher Education (decision no. 05 1/KNOW2/2015) (in silico analyses).

Conflict of interest statement

The authors declare that they have no conflicts of interest.