Appendix 1—key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Mus musculus) |
Cobl-like
(Cobll1) |
Izadi et al., 2018 |
AK144943.1, GI: 74201418 |
|
| Gene (Mus musculus) |
Cordon-Bleu
(Cobl) |
Ahuja et al., 2007 |
NM_172496.3, GI: 162135965 |
The common abbreviation of Cordon-Bleu is Cobl |
| Gene (Rattus norvegicus) |
Syndapin I
(Pacsin1) |
Braun et al., 2005 |
AF104402.1, GI: 4324451 |
Syndapin is used as gene name in most model organisms, such as rat, worms, flies |
| Gene (Rattus norvegicus) |
Calmodulin
(Calm1) |
SenGupta et al., 1987 |
M19312.1, GI: 203255 |
The common abbreviation of calmodulin is CaM |
| Strain, background (Escherichia coli) |
E. coli commercial strain BL21-CodonPlus(DE3)-RIPL | Agilent | Cat#230280 | |
| Strain, background (Escherichia coli) |
E. coli commercial strain XL10-Gold | Agilent | Cat#200314 | |
| Cell line (African green monkey) | COS-7 | Cell Lines Services GmbH | RRID:CVCL_0224 | |
| Cell line (human) | HEK293 | Cell Lines Services GmbH | RRID:CVCL_0045 | |
| Biological sample (Rattus norvegicus) |
Primary hippocampal neurons (Wistar rat; Crl:WI; mixed sex) | Charles River | RRID:RGD_68115 | Primary neurons isolated from E18 rat embryos (sex undetermined) |
| Biological sample (Mus musculus) |
Isolated brains (Mouse strain C57BL/6J, female) | Jackson Labs | RRID:IMSR_JAX:000664 | Brain material processed for protein biochemical examinations |
| Antibody | Anti-Cobl-like (Rabbit polyclonal) |
Izadi et al., 2018 | N/A | WB (1:1000) |
| Antibody | Anti-syndapin I (Guinea pig polyclonal) |
Braun et al., 2005 | N/A | WB (1:500) EM (1:50) |
| Antibody | Anti-syndapin III (Guinea pig polyclonal) |
Koch et al., 2011 | N/A | WB (1:500) |
| Antibody | Anti-TrxHis (Rabbit polyclonal) |
This paper | N/A | WB (1:1000) |
| Antibody | Anti-GST (Rabbit polyclonal) |
Qualmann and Kelly, 2000 | N/A | WB (1:1000) |
| Antibody | Anti-TrxHis (Guinea pig polyclonal) |
Schwintzer et al., 2011 | N/A | WB (1:2000) |
| Antibody | Anti-GST (Guinea pig polyclonal) |
Braun et al., 2005 | N/A | WB (1:1000) |
| Antibody | Anti-GFP (ab290) (Rabbit polyclonal) |
Abcam | Cat#ab290 RRID:AB_303395 |
WB (1:2000) |
| Antibody | Anti-GFP (JL-8) (Mouse monoclonal) |
Clontech | Cat#632380 RRID:AB_10013427 | WB (1:4000) |
| Antibody | Anti-Flag antibody (M2) (Mouse monoclonal) |
Sigma-Aldrich | Cat#F3165 RRID:AB_259529 |
WB (1:500) |
| Antibody | Anti-MAP2 (HM-2) (Mouse monoclonal) |
Sigma-Aldrich | Cat#M4403 RRID:AB_477193 |
IF (1:500) |
| Antibody | Anti-Flag antibody (Rabbit polyclonal) |
Sigma-Aldrich | Cat#F7425 RRID:AB_439687 |
WB (1:1000) |
| Antibody | Anti-Xpress antibody (Mouse monoclonal) |
Invitrogen | Cat#R910-25; RRID:AB_2556552 |
IF (1:500) |
| Antibody | Alexa Fluor488-labeled goat anti-guinea pig (Goat polyclonal) |
Molecular Probes | Cat#A-11073 RRID:AB_142018 | IF (1:1000) |
| Antibody | Alexa Fluor568-labeled goat anti-guinea pig (Goat polyclonal) |
Molecular Probes | Cat#A-11075 RRID:AB_141954 | IF (1:1000) |
| Antibody | Alexa Fluor488-labeled donkey anti-mouse (Donkey polyclonal) |
Molecular Probes | Cat#A-21202 RRID:AB_141607 | IF (1:1000) |
| Antibody | Alexa Fluor568-labeled donkey anti-mouse (Donkey polyclonal) |
Molecular Probes | Cat#A10037 RRID:AB_2534013 | IF (1:1000) |
| Antibody | Alexa Fluor647-labeled goat anti-mouse (Goat polyclonal) |
Molecular Probes | Cat#A-21236 RRID:AB_141725 | IF (1:1000) |
| Antibody | Alexa Fluor488-labeled donkey anti-rabbit (Donkey polyclonal) |
Molecular Probes | Cat#A-21206 RRID:AB_141708 | IF (1:1000) |
| Antibody | Alexa Fluor568-labeled goat anti-rabbit (Goat polyclonal) |
Molecular Probes | Cat#A-11036 RRID:AB_143011 | IF (1:1000) |
| Antibody | Alexa Fluor647-labeled goat anti-rabbit (Goat polyclonal) |
Molecular Probes | Cat#A-21245 RRID:AB_141775 | IF (1:1000) |
| Antibody | Alexa Fluor680-labeled goat-anti-rabbit (Goat polyclonal) |
Molecular Probes | Cat#A-21109 RRID:AB_2535758 | WB (1:10000) |
| Antibody | Alexa Fluor680-labeled goat-anti-mouse (Goat polyclonal) |
Molecular Probes | Cat#35519 RRID:AB_1965956 | WB (1:10000) |
| Antibody | DyLight800-conjugated goat anti-rabbit (Goat polyclonal) |
Thermo Fisher Scientific | Cat#SA5-35571 RRID:AB_2556775 | WB (1:10000) |
| Antibody | DyLight800-conjugated goat anti-mouse (Goat polyclonal) |
Thermo Fisher Scientific | Cat#SA5-35521 RRID:AB_2556774 | WB (1:10000) |
| Antibody | IRDye680-conjugated donkey anti-guinea pig (Donkey polyclonal) |
LI-COR Bioscience | Cat#926–68077 RRID:AB_10956079 | WB (1:10000) |
| Antibody | IRDye800-conjugated donkey anti-guinea pig (Donkey polyclonal) |
LI-COR Bioscience | Cat#926–32411 RRID:AB_1850024 | WB (1:10000) |
| Antibody | Peroxidase-AffiniPure donkey anti-rabbit antibody (Donkey polyclonal) |
Jackson ImmunoResearch Labs | Cat#711-035-152 RRID:AB_10015282 |
WB (1:5000) |
| Antibody | Peroxidase-AffiniPure goat anti-guinea pig antibody (Goat polyclonal) |
Jackson ImmunoResearch Labs | Cat#106-036-003 RRID:AB_2337405 |
WB (1:5000) |
| Antibody | Peroxidase-goat F(ab')2 anti-mouse (Goat polyclonal) |
Dianova | Cat#115-036-003 RRID:AB_2617176 |
WB (1:5000) |
| Antibody | Goat anti-guinea pig IgG 10 nm gold (Goat polyclonal) |
BBI Solutions | Cat#EM.GAG10 RRID:AB_2892072 |
EM (1:50) |
| Recombinant DNA reagent | Flag-mCherry Cobl (Plasmid) | This paper | N/A | See Materials and methods |
| Recombinant DNA reagent | GFP-Cobl-like (Plasmid) | Izadi et al., 2018 | N/A | |
| Recombinant DNA reagent | Scr. RNAi in pRNAT-H1.1 (Plasmid) | Pinyol et al., 2007 | N/A | |
| Recombinant DNA reagent | Scr. RNAi in pRNAT-mCherryF (Plasmid) | Schneider et al., 2014 | N/A | |
| Recombinant DNA reagent | Cobl-RNAi in pRNAT-mCherryF (Plasmid) | This paper | N/A | See Materials and methods |
| Recombinant DNA reagent | Cobl-like RNAi (#1) in pRNAT-H1.1 (Plasmid) | Izadi et al., 2018 | N/A | |
| Recombinant DNA reagent | Cobl-like RNAi (#1) in pRNAT-mCherryF (Plasmid) | This paper | N/A | See Materials and methods |
| Recombinant DNA reagent | GFP-Cobl (Plasmid) | Hou et al., 2015 | N/A | |
| Recombinant DNA reagent | GFP-Cobl1-713 (Plasmid) | Hou et al., 2015 | N/A | |
| Recombinant DNA reagent | Mito-GFP-Cobl1-713 (Plasmid) | This paper | N/A | |
| Recombinant DNA reagent | GFP-Cobl-like1-741 (Plasmid) | This paper | N/A | See Materials and methods |
| Recombinant DNA reagent | GFP-Cobl-like740-1273 (Plasmid) | Izadi et al., 2018 | N/A | |
| Recombinant DNA reagent | GFP-Cobl-like1-538 (Plasmid) | This paper | N/A | See Materials and methods |
| Recombinant DNA reagent | GFP-Cobl-like1-411 (Plasmid) | This paper | N/A | See Materials and methods |
| Recombinant DNA reagent | GFP-Cobl-like1-380 (Plasmid) | This paper | N/A | See Materials and methods |
| Recombinant DNA reagent | GFP-Cobl-like376-540 (Plasmid) | This paper | N/A | See Materials and methods |
| Recombinant DNA reagent | GFP-Cobl-like261-380 (Plasmid) | This paper | N/A | See Materials and methods |
| Recombinant DNA reagent | GFP-Cobl-like111-262 (Plasmid) | This paper | N/A | See Materials and methods |
| Recombinant DNA reagent | GFP-Cobl-like1-111 (Plasmid) | This paper | N/A | See Materials and methods |
| Recombinant DNA reagent | GFP-Cobl-like537-740 (Plasmid) | This paper | N/A | See Materials and methods |
| Recombinant DNA reagent | GFP-Cobl-like182-272 (Plasmid) | This paper | N/A | See Materials and methods |
| Recombinant DNA reagent | GFP-Cobl-like1-58 (Plasmid) | This paper | N/A | See Materials and methods |
| Recombinant DNA reagent | Cobl-like RNAi/GFP-Cobl-like* in pRNAT H1.1 (Plasmid) | Izadi et al., 2018 | N/A | |
| Recombinant DNA reagent | Cobl-like RNAi/GFP-Cobl-like*∆CaM NT in pRNAT H1.1 (Plasmid) | This paper | N/A | See Materials and methods |
| Recombinant DNA reagent | mCherry-Cobl-like1-711 | This paper | N/A | See Materials and methods |
| Recombinant DNA reagent | GFP-Cobl-like1-741∆CaM NT (Plasmid) | This paper | N/A | See Materials and methods |
| Recombinant DNA reagent | GFP-Cobl-like∆KRAP (Plasmid) | This paper | N/A | See Materials and methods |
| Recombinant DNA reagent | GFP-Cobl-like1-741∆KRAP (Plasmid) | This paper | N/A | See Materials and methods |
| Recombinant DNA reagent | GFP-Cobl-like1-457∆KRAP1 (Plasmid) | This paper | N/A | See Materials and methods |
| Recombinant DNA reagent | GFP-Cobl-like1-457 (Plasmid) | This paper | N/A | See Materials and methods |
| Recombinant DNA reagent | Cobl-like RNAi/GFP-Cobl-like*∆KRAP1 in pRNAT H1.1 (Plasmid) | This paper | N/A | See Materials and methods |
| Recombinant DNA reagent | Cobl-like RNAi/GFP-Cobl-like*∆1-412 in pRNAT H1.1 (Plasmid) | This paper | N/A | See Materials and methods |
| Recombinant DNA reagent | Flag-syndapin I (SdpI) (Plasmid) | Qualmann and Kelly, 2000 | N/A | |
| Recombinant DNA reagent | Flag-syndapin II-s (SdpII) (Plasmid) | Dharmalingam et al., 2009 | N/A | |
| Recombinant DNA reagent | Flag-syndapin III (SdpIII) (Plasmid) | Braun et al., 2005 | N/A | |
| Recombinant DNA reagent | Xpress-syndapin I (SdpI) (Plasmid) | Qualmann et al., 1999 | N/A | |
| Recombinant DNA reagent | Syndapin I–mRubyRFP (Plasmid) | This paper | N/A | See Materials and methods |
| Recombinant DNA reagent | GFP-syndapin I (Plasmid) | Kessels and Qualmann, 2006 | N/A | |
| Recombinant DNA reagent | Mito-mCherry-SdpI (Plasmid) | Kessels and Qualmann, 2002 | N/A | |
| Recombinant DNA reagent | Mito-mCherry-SdpI∆SH3 (Plasmid) | Braun et al., 2005 | N/A | |
| Recombinant DNA reagent | Mito-mCherry (Plasmid) | Dharmalingam et al., 2009 | N/A | |
| Recombinant DNA reagent | SdpI-RNAi in pRNAT-mCherryF (Plasmid) |
Dharmalingam et al., 2009
Schneider et al., 2014 |
N/A | |
| Recombinant DNA reagent | GFP-CaM (Plasmid) | This paper | N/A | See Materials and methods |
| Sequence-based reagent | Cobl-like aa1 fw | This paper | PCR primer | 5’-AATTAGATCTATGGACCGCAGCGTCCCCGATCC-3’ (see Materials and methods) |
| Sequence-based reagent | Cobl-like aa261 fw | This paper | PCR primer | 5’-AAAGATCTGATATCAGCAGAGAG-3’ (see Materials and methods) |
| Sequence-based reagent | Cobl-like aa537 fw | This paper | PCR primer | 5’-AAAGATCTAAGGATCCTGATTCAGC-3’ (see Materials and methods) |
| Sequence-based reagent | Cobl-like aa740 fw | This paper | PCR primer | 5’-GCCTCAAGAGAATTCAGG-3’ (see Materials and methods) |
| Sequence-based reagent | Cobl-like aa376 fw | This paper | PCR primer | fw: 5’-TTGAATTCTTAAACCATGATCGCTTC-3’ (see Materials and methods) |
| Sequence-based reagent | Cobl-like aa182 fw | This paper | PCR primer | 5’- TTAGATCTCCTACACCTATAATC-3’ (see Materials and methods) |
| Sequence-based reagent | Cobl-like aa457 rv | This paper | PCR primer | 5’- AACTCGAGCCCGGGACCAAGGGAGC-3’ (see Materials and methods) |
| Sequence-based reagent | Cobl-like aa741 rv | This paper | PCR primer | 5’-TCCTGAATTCTCTTGAGG-3’ (see Materials and methods) |
| Sequence-based reagent | Cobl-like aa540 rv | This paper | PCR primer | 5’-TTCTCGAGTTAATCAGGATCCTTCTC-3’ (see Materials and methods) |
| Sequence-based reagent | Cobl-like aa411 rv | This paper | PCR primer | 5’-GCAAGCTTGGTTTTCGAAGGTGG-3’ (see Materials and methods) |
| Sequence-based reagent | Cobl-like aa272 rv | This paper | PCR primer | 5’-AAGAATTCTCAGTTGTGTGATATTTG-3’ (see Materials and methods) |
| Sequence-based reagent | Cobl-like aa380 rv | This paper | PCR primer | 5’-TTGAATTCGAAGCGATCATGGTG-3’ (see Materials and methods) |
| Sequence-based reagent | Cobl-like∆CaM NT aa1-10+46–51 fw | This paper | PCR primer | 5’-AAAGATCTATGGACCGCAGCGT
CCCGGATCCCGTACCCAAGAATCAC AAATTCCTG-3’ (see Materials and methods) |
| Sequence-based reagent | Cobl-like aa413 fw | This paper | PCR primer | 5’-TTAAGCTTCTGGCTCAGAC
TGATG-3’ (see Materials and methods) |
| Sequence-based reagent | Cobl-like aa58 rv | This paper | PCR primer | 5’-TTAAGCTTGCTCTGACAAATATG-3’ (see Materials and methods) |
| Sequence-based reagent | Cobl-like aa70 fw | This paper | PCR primer | 5’-TTAAGCTTGCCGAGACGAAGGGC-3’ (see Materials and methods) |
| Sequence-based reagent | Cobl-like aa333 rv | This paper | PCR primer | 5’-TTAAGCTTTGCATCCGAGGGC-3’ (see Materials and methods) |
| Sequence-based reagent | Cobl-like aa411 rv Sal I | This paper | PCR primer | 5’-GGGTCGACGGTTTTCGAAGGTGG-3’ (see Materials and methods) |
| Recombinant protein | TrxHis | Hou et al., 2015 | N/A | |
| Recombinant protein | TrxHis-Cobl-like1-411 | This paper | N/A | |
| Recombinant protein | GST-Cobl-like1-411 | This paper | N/A | |
| Recombinant protein | GST-SdpISH3 | Qualmann et al., 1999 | N/A | |
| Recombinant protein | GST-SdpIISH3 | Qualmann and Kelly, 2000 | N/A | |
| Recombinant protein | GST-SdpIIISH3 | Seemann et al., 2017 | N/A | |
| Recombinant protein | GST-SdpI | Qualmann et al., 1999 | N/A | |
| Recombinant protein | GST-SdpISH3mut | Qualmann and Kelly, 2000 | N/A | |
| Commercial assay or kit | NucleoSpin Plasmid | Macherey-Nagel | Cat#740588.50 | |
| Commercial assay or kit | NucleoBond Xtra Midi | Macherey-Nagel | Cat#740410.50 | |
| Commercial assay or kit | Lipofectamine 2000 transfection reagent | Invitrogen | Cat#11668019 | |
| Commercial assay or kit | Turbofect transfection reagents | Thermo Fisher Scientific | Cat#R0532 | |
| Commercial assay or kit | Calmodulin Sepharose 4B | GE Healthcare | Cat#GE17-0529-01 | |
| Commercial assay or kit | PreScission protease | GE Healthcare | Cat#27-0843-01 | |
| Chemical compound, drug | MitoTracker Deep Red Alexa Fluor633 | Molecular Probes | Cat#M22426 | |
| Software, algorithm | ZEN2012 | Zeiss | RRID:SCR_013672 | |
| Software, algorithm | Prism5, Prism6 | GraphPad Prism | RRID:SCR_002798 | |
| Software, algorithm | ImageJ | Other | RRID:SCR_003070 | Open source software |
| Software, algorithm | IMARIS 7.6 | Bitplane | RRID:SCR_007370 | |
| Software, algorithm | Adobe Photoshop | Adobe | RRID:SCR_014199 |