Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Mus musculus, females and males) | NOD-FRG mice | DOI: 10.1038/nbt1326 DOI : 10.1074/jbc.M115.662999 | Breeding and experimentation in PBES – originally purchased to YEcuris corporation | |
| Strain, strain background (HBV) | Hepatitis B virus (HBV) | This paper | HBV, genotype D, produced by co-transfection of HepG2.2.15 cells with plasmids pCiHB(env-) and pT7HB2.7 | |
| Strain, strain background (HDV) | Hepatitis D virus (HDV) | This paper | HDV, genotype 1, produced by co-transfection of Huh7 cells with plasmids pSVLD3 and pT7HB2.7 or variant constructs | |
| Cell line (Homo sapiens) | Huh7 - hepatocarcinoma cells | PMID:6286115 | ||
| Cell line (Homo sapiens) | Huh7-NTCP | This paper | Generated by transduction with pLX304NTCP retroviral vector and selection with blasticidin | |
| Cell line (Homo sapiens) | Huh7-Tat (H-tat) cells | This paper | Generated by transduction with LXSN-tat retroviral vector and selection with G418 | |
| Cell line (Homo sapiens) | H-tat cells down-regulated for ERp46, ERp57, or ERp72 | This paper | Generated by transduction of H-tat cells with shRNA lentiviral vectors against ERp46, ERp57, or ERp72 followed by selection with puromycin | |
| Cell line (Homo sapiens) | Huh7-NTCP-Tat (N-tat) cells | This paper | Generated by transduction of Huh7-NTCP cells with LXSN-tat retroviral vector | |
| Cell line (Homo sapiens) | N-tat cells down-regulated for ERp46, ERp57, or ERp72 | This paper | Generated by transduction of N-tat cells with shRNA lentiviral vectors against ERp46, ERp57, or ERp72 followed by selection with puromycin | |
| Cell line (Homo sapiens) | HepG2.2.15 human hepatoma cells | From David Durantel lab | Production of HBV particles | |
| Cell line (Homo sapiens) | 293T human kidney cells | ATCC | CRL-1573 | Production of retro- and lentiviral particles |
| Cell line (Cricetulus griseus, female) | CHO-K1 Chinese hamster ovary cells | ATCC | CCL-61 | Cell-cell fusion assays |
| Transfected construct (human) | pLX304NTCP | DNASU plasmid repository | HQ447437 | Retroviral construct to transfect and express NTCP |
| Transfected construct (HBV) | pSVLD3 | DOI: 10.1128/JVI.63.5.1945–1950.1989 | Harbors a trimer of the HDV, genotype 1 genome. Used for production of HDV particles | |
| Transfected construct (HBV) | pT7HB2.7 | DOI: 10.1128/JVI.68.6.4063–4066.1994 | Gift from Camille Sureau, used for production of HBV and HDV particles and expression of HBV envelope proteins | |
| Transfected construct (HBV) | pT7HB2.7Mless (noM) | This paper | Generated for expression of HBV L and S proteins (M protein is silenced) | |
| Transfected construct (HBV) | pCiL | DOI: 10.1128/JVI.77.9.5519–5523.2003 | Encodes only the L-HBsAg protein | |
| Transfected construct (HBV) | pCIS | DOI: 10.1128/JVI.80.10.4648–4655.2006 | Encodes only the S-HBsAg protein | |
| Transfected construct (CCHFV) | pCAGGS_GP/wt-M | DOI: 10.1128/JVI.03691–14 | Major open reading frame of CCHFV M-segment subcloned into pCAGGS | |
| Transfected construct (HBV) | pCIHB(env-) | DOI: 10.1128/JVI.00621–06 | Gift from Camille Sureau, used for production of HBV particles | |
| Transfected construct (HIV1-Tat) | LXSN-tat retroviral vector | DOI: 10.1128/JVI.73.3.1956–1963.1999 | HIV-1 tat gene cloned into the LXSN retroviral vector | |
| Transfected construct (HIV1-LTR) | pLTR-luc | DOI: 10.1016/0378-1119(90)90032 m | Gift from Olivier Schwartz, contains a 722-base pair XhoI (−644)-HindIII (+78) fragment from HIV-1 placed in front of the luciferase reporter gene | |
| Transfected construct (VSV) | phCMV-VSV-G | DOI: 10.1016/s0091-679x(08)60600–7 | To express the envelope protein of VSV | |
| Transfected construct (human) | shRNA against ERp46 (ERp46-shRNA 1) | Sigma | NM_022085 / TRCN0000064353 / PLKO.1 | Lentiviral construct to transfect and express the shRNA |
| Transfected construct (human) | shRNA against ERp46 (ERp46-shRNA 2) | Sigma | NM_022085 / TRCN0000064354 / PLKO.1 | Lentiviral construct to transfect and express the shRNA |
| Transfected construct (human) | shRNA against ERp57 (ERp57-shRNA 3) | Sigma | NM_005313 / TRCN0000319038 / PLKO | Lentiviral construct to transfect and express the shRNA |
| Transfected construct (human) | shRNA against ERp57 (ERp57-shRNA 4) | Sigma | NM_005313 / TRCN0000147738 / PLKO.1 | Lentiviral construct to transfect and express the shRNA |
| Transfected construct (human) | shRNA against ERp72 (ERp72-shRNA 3) | Sigma | NM_004911 / TRCN0000289676 / PLKO.1 | Lentiviral construct to transfect and express the shRNA |
| Transfected construct (human) | shRNA against ERp72 (ERp72-shRNA 4) | Sigma | NM_004911 / TRCN0000049334 / PLKO.1 | Lentiviral construct to transfect and express the shRNA |
| Transfected construct (human) | shRNA against ERp72 (ERp72-shRNA 5) | Sigma | NM_004911 / TRCN0000307107 / PLKO.1 | Lentiviral construct to transfect and express the shRNA |
| Biological sample (M. musculus) | Blood samples | PBES (Plateau de Biologie Experimentale de la Souris) SFR Biosciences Lyon | Isolated from NOD-FRG mice | |
| Antibody | Anti-HBsAg antibody, HPR conjugated (goat polyclonal) | DiaSorin | 9F80-01 | WB (1:400) |
| Antibody | Anti-human calnexin (rabbit polyclonal) | Enzo | ADI-SPA-865-F | WB (1:1000) |
| Antibody | Anti-mouse TXNDC5/ERp46 (rabbit polyclonal) | Abcam | Ab10292 | FACS (1:20) WB (1:1000) |
| Antibody | Anti-human ERp57 (mouse monoclonal) | Abcam | Ab13506 | FACS (2 μg/106 cells) WB (1:10,000) IF (1:100) |
| Antibody | Anti-human ERp72 (rabbit polyclonal) | Abcam | Ab155800 | FACS (1:100) WB (1:1000) |
| Antibody | Anti-human NTCP/SLC10A1 antibody, PE conjugated (rabbit polyclonal) | Bioss Antibodies | bs-1958R-PE | FACS (1:100) |
| Antibody | Anti-human Rab5 (rabbit monoclonal) | Cell Signaling Technology | (C8B1):3547 | IF (1:200) |
| Antibody | Anti-human Rab7 (rabbit monoclonal) | Cell Signaling Technology | (D95F2):9367 | IF (1:100) |
| Antibody | Anti-human Rab11 (rabbit monoclonal) | Cell Signaling Technology | (D4F5):5589 | IF (1:50) |
| Antibody | Anti-human Lamp1 (rabbit monoclonal) | Cell Signaling Technology | (D2D11):9091 | IF (1:200) |
| Sequence-based reagent | F52A | This paper | preS1 mutagenesis PCR primers | GTAGGAGCTGGAGCAG CCGGGCTGGGTTTCAC |
| Sequence-based reagent | F52E | This paper | preS1 mutagenesis PCR primers | GTAGGAGCTGGAGCAGA AGGGCTGGGTTTCAC |
| Sequence-based reagent | G53A | This paper | preS1 mutagenesis PCR primers | CTGGAGCATTCGCGCT GGGTTTCAC |
| Sequence-based reagent | F56A | This paper | preS1 mutagenesis PCR primers | TTCGGGCTGGGTGCC ACCCCACCGCA |
| Sequence-based reagent | W66A | This paper | preS1 mutagenesis PCR primers | GAGGCCTTTTGGGGGCG AGCCCTCAGGCTC |
| Sequence-based reagent | W66E | This paper | preS1 mutagenesis PCR primers | GAGGCCTTTTGGGGGAG AGCCCTCAGGCTC |
| Sequence-based reagent | Y129A | This paper | preS2 mutagenesis primers | GAGTGAGAGGCCTGGCTT TCCCTGCTGGTG |
| Sequence-based reagent | F130A | This paper | preS2 mutagenesis primers | GAGAGGCCTGTATGCCCC TGCTGGTGG |
| Sequence-based reagent | S136E | This paper | preS2 mutagenesis primers | CCCTGCTGGTGGCTCCGAA TCAGGAACAGTAAAC |
| Sequence-based reagent | L144A | This paper | preS2 mutagenesis primers | CAGTAAACCCTGTTGCGACT ACTGCCTCTCC |
| Sequence-based reagent | T303C | This paper | CSD mutagenesis primers | CCTCCTGTTGCTGTTGCAAA CCTTCGGACG |
| Sequence-based reagent | G308C | This paper | CSD mutagenesis primers | GTACCAAACCTTCGGACTGT AATTGCACCTGTATTCCC |
| Sequence-based reagent | TG/CC | This paper | CSD mutagenesis primers | GTTGCAAACCTTCGGACTGT AATTGCACCTGTATTCCC |
| Commercial assay or kit | FuGENE HD Trasnfection Reagent | Promega | E2312 | Transfection reagent |
| Commercial assay or kit | Dual-Luciferase Reporter Assay System | Promega | E1910 | Quantification of luciferase activity |
| Commercial assay or kit | iScript cDNA synthesis kit | Bio-Rad | 1708891 | cDNA synthesis |
| Commercial assay or kit | FastStart Universal SYBR Green Master | Roche Sigma |
4913850001 | Real-time qPCR assays |
| Commercial assay or kit | CytoTox-ONE Homogen Membrane Integrity Assay | Promega | G7891 | Cytotoxicity assay |
| Chemical compound, drug | Bacitracin | Sigma | B0125-250KU | Water |
| Chemical compound, drug | NTZ (nitazoxanide) | Sigma | N0290-50MG | DMSO |
| Chemical compound, drug | EGCG ((−)-epigallocatechin gallate) |
Sigma | E4268-100MG | Water |
| Chemical compound, drug | Rutin Hydrate | Sigma | R5143-50G | DMSO |
| Chemical compound, drug | PX-12 | Sigma | M5324-5MG | DMSO |
| Chemical compound, drug | DTNB (5,5′-dithiobis(2-nitrobenzoic acid)) | Sigma | D218200-1G | DMSO |
| Chemical compound, drug | EZ-Link Sulfo-NHS-LC-LC-Biotin | Life technologies | 21338 | |
| Software, algorithm | ImaJ software | ImaJ | RRID:SCR_003070 | |
| Software, algorithm | Membrane Protein eXplorer | http://blanco.biomol.uci.edu/mpex/ | RRID:SCR_014077 | |
| Software, algorithm | RaptorX | http://raptorx.uchicago.edu/ | RRID:SCR_018118 | |
| Software, algorithm | Jpred | http://www.compbio.dundee.ac.uk/jpred/ | RRID:SCR_016504 | |
| Software, algorithm | MODELLER | http://salilab.org/modeller/modeller.html | RRID:SCR_008395 | |
| Software, algorithm | Clustal X | http://www.clustal.org/clustal2/ | RRID:SCR_017055 | |
| Software, algorithm | Molecular Modelling Toolkit | http://dirac.cnrs-orleans.fr/MMTK.html | ||
| Software, algorithm | GROMACS | http://www.gromacs.org | RRID:SCR_014565 | |
| Software, algorithm | UCSF Chimera | http://plato.cgl.ucsf.edu/chimera/ | RRID:SCR_004097 | |
| Other | Hoechst 33342 stain | Thermo Fisher | H3570 | 10 μg/ml |
| Other | Streptavidin Agarose Resin | Thermo Fisher | 20353 | |
| Other | TRI-Reagent | Molecular Research Center Euromedex |
TR118-200 | RNA extraction |