Skip to main content
. Author manuscript; available in PMC: 2022 Jul 13.
Published in final edited form as: Immunity. 2021 May 19;54(7):1527–1542.e8. doi: 10.1016/j.immuni.2021.04.022

Key Resources Table

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
Anti-APC Antibody Millipore Sigma Cat#OP80; RRID: AB_2057371
Anti-BrdU antibody Abcam Cat#ab6326; RRID: AB_305426
Anti-CD28 Antibody Thermo Fisher Scientific Cat#14-0281; RRID: AB_467191
Anti-CD29 Antibody Thermo Fisher Scientific Cat# 14-0291-82; RRID: AB_657727
Anti-CD3e Antibody Thermo Fisher Scientific Cat#14-0031; RRID: AB_467050
Anti-GFP Antibody Thermo Fisher Scientific Cat#G10362; RRID: AB_2536526
Anti-Iba1Antibody Abcam Cat# ab5076; RRID: AB_2224402
Anti-IL-2 Antibody Thermo Fisher Scientific Cat#16-7022-85; RRID: AB_469207
Anti-MAP2 Antibody Santa Cruz Cat# sc-20172; RRID: AB_2250101
Anti-MBP Antibody Abcam Cat# ab40390; RRID: AB_1141521
Anti-NF-H Antibody (SMI32) BioLegend Cat# 801701; RRID: AB_2564642
Anti-NG2 Antibody Millipore Sigma Cat#AB5320; RRID: AB_11213678
Anti-Osteopontin Antibody Abcam Cat#ab8448; RRID: AB_306566
Anti-TGM2 Antibody R&D Systems Cat# AF4376; RRID: AB_10890213
Anti-VEGF-A Antibody Biolegend Cat# 512809; RRID: AB_2814439
Anti-Arg1 Antibody, APC R&D Systems Cat# IC5868A; RRID: AB_2810265
Anti-CD11b Antibody, APC BioLegend Cat# 101211; RRID: AB_312794
Anti-CD25 Antibody, Alexa Fluor® 700 BioLegend Cat# 102024; RRID: AB_493709
Anti-CD25 Antibody, APC BioLegend Cat# 102012; RRID: AB_312861
Anti-CD25 Antibody, PE Thermo Fisher Scientific Cat# 12-0251; RRID: AB_465607
Anti-CD29 (Integrin beta 1) Antibody, PE Thermo Fisher Scientific Cat#12-0291-81; RRID: AB_657733
Anti-CD3 Antibody, APC-Cy7 BioLegend Cat# 100221; RRID: AB_2057374
Anti-CD3 Antibody, FITC Thermo Fisher Scientific Cat# 11-0032-80; RRID: AB_2572430
Anti-CD4 Antibody, BUV395 BD Biosciences Cat#563790; RRID: AB_2738426
Anti-CD4 Antibody, BV510 BioLegend Cat # 100449; RRID: AB_2564587
Anti-CD4 Antibody, ef450 Thermo Fisher Scientific Cat# 48-0042; RRID: AB_1272194
Anti-CD45 Antibody, PE-Cyanine5 Thermo Fisher Scientific Cat#15-0451-81; RRID: AB_468751
Anti-CD45 Antibody, PE-CF594 BD Biosciences Cat#562420; RRID: AB_11154401
Anti-CTLA4 Antibody, BV605 Biolegend Cat# 106323; RRID: AB_2566467
Anti-Foxp3 Antibody, APC Thermo Fisher Scientific Cat#17-5773-82; RRID: AB_469457
Anti-Foxp3 Antibody, PE-Cy7 Thermo Fisher Scientific Cat# 25-5773-82; RRID: AB_891552
Anti-GLAST Antibody, APC Miltenyi Biotec Cat# 130-123-555; RRID: AB_2811532
Anti-Helios Antibody, FITC Biolegend Cat# 137214; RRID: AB_10662745
Anti-Human and Sheep IgG Fc Antibody, APC-Cy7 Biolegend Cat# 409313; RRID: AB_2561858
Anti-IL-10 Antibody, APC-Cy7 Biolegend Cat# 505035; RRID: AB_2566330
Anti-O4 Antibody, APC Miltenyi Biotec Cat#130-119-155; RRID: AB_2751644
Anti-Osteopontin Antibody, PE R&D Systems Cat# IC808P; RRID: AB_10643832
Anti-Rat IgG Antibody, BV421 Biolegend Cat# 405414; RRID: AB_10900808
IgG2a kappa Isotype antibody Thermo Fisher Scientific Cat#: 16-4321-82; AB_470156
Chemicals, Peptides, and Recombinant Proteins
Diphtheria Toxin Sigma-Aldrich Cat#D0564-1MG
IL-2, Recombinant Protein Thermo Fisher Scientific Cat#34-8021-85
Luxol® Fast Blue MBSN Sigma-Aldrich Cat#S3382-25G
Osteopontin Protein R&D Systems Cat#441OP050CF
Percoll GE Healthcare Cat#17-0891-01
PLX5622 Chemgood Cat#C-1521
(Z)-4-Hydroxytamoxifen Sigma-Aldrich Cat#H7904
Critical Commercial Assays
CD4+CD25+ Regulatory T Cell Isolation Kit, mouse Miltenyi Biotec Cat# 130-091-041
Mouse on Mouse (M.O.M.) Basic Kit Vector laboratories Cat#BMK-2202
Neural Tissue Dissociation Kit (T) Miltenyi Biotec Cat#130-093-231
Nextera XT DNA Library Prep Kit Illumina Cat#15031942
RNeasy Plus Micro Kit Qiagen Cat#74034
SMART-Seq HT Kit Takara Bio Cat#634456
SMART-Seq Ultralow Input RNA Kit Takara Bio Cat#634890
UltraComp eBeads Compensation Beads Thermo Fisher Scientific Cat#01-2222-42
Deposited Data
Raw data files for RNA-seq This paper GEO: GSE171171
Experimental Models: Organisms/Strains
Mouse: C57BL/6J (WT) The Jackson Laboratory Stock No: 000664
Mouse: Cx3crcre/ER The Jackson Laboratory Stock No: 021160
Mouse: Foxp3DTR/GFP The Jackson Laboratory Stock No: 016958
Mouse: Itgb1flox/flox The Jackson Laboratory Stock No: 004605
Mouse: Rag1−/− The Jackson Laboratory Stock No: 002216
Mouse: Spp1−/− The Jackson Laboratory Stock No: 004936
Oligonucleotides
qPCR primer Mbp: Thermo Fisher Scientific F:CACAGAAGAGACCCTCACAGCGACA
R:CCGCTAAAGAAGCGCCCGATGGA
qPCR primer Spp1: Thermo Fisher Scientific F:GAATCTCCTTGCGCCACAGAATG
R:CATCTGTGGCATCAGGATACTGTTC
qPCR primer Gapdh: Thermo Fisher Scientific F: TGCTGGTGCTGAGTATGTCGTG
R: CGGAGATGATGACCCTTTTGG
Software and Algorithms
Cell Ranger 3.0.1 10xGenomics https://support.10xgenomics.com/single-cell-gene-expression/software/pipelines/latest/what-is-cell-ranger
Chipster 3.15 CSC-IT Center for Science https://chipster.csc.fi/
DESeq2 Bioconductor http://bioconductor.org/packages/DESeq2/
DSI studio (Yeh et al., 2013) http://dsi-studio.labsolver.org/
edgeR 3.26.8 Bioconductor http://bioinf.wehi.edu.au/edgeR
FastQC Babraham Bioinformatics http://www.bioinformatics.babraham.ac.uk/projects/fastqc/
FlowJo 10.5.3 TreeStar FlowJo LLC. https://www.flowjo.com/
GraphPad Prism 8.4.3 GraphPad Software https://www.graphpad.com
GSEA 4.0.1 UC San Diego and Broad Institute http://gsea-msigdb.org/gsea/index.jsp
HTSeq (Anders et al., 2015) http://htseq.readthedocs.io/
ImageJ NIH https://imagej.nih.gov/ij/
Imaris 9.3 Bitplane https://imaris.oxinst.com/
Ingenuity Pathway Analysis Qiagen http://qiagen.force.com/KnowledgeBase/KnowledgeIPAPage
pClamp 10 software Molecular Devices, LLC https://www.moleculardevices.com/products/axon-patch-clamp-system
R 3.5 R https://www.r-project.org/
Seurat 2.3.4 (Stuart et al., 2019) https://cran.r-project.org/web/packages/Seurat
STAR 2.7.8 GitHub https://github.com/alexdobin/STAR
STRING 11.0 STRING https://string-db.org/