Key resources table.
Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
---|---|---|---|---|
Gene (mouse) | Rhot1 | GenBank | Gene ID: 59040 | |
Strain, strain background (include species and sex here) | Mouse B6;129S−Gt(ROSA)26Sortm1(CAG−COX8A/Dendra2)Dcc/J | The Jackson Laboratory | Stock number 018385 | |
Strain, strain background (include species and sex here) | Mouse: Rhot1tm1a (EUCOMM)Wtsi |
Wellcome Trust Sanger Institute | MBTN EPD0066 2 F01 | |
Strain, strain background (include species and sex here) | Mouse: B6;129S−Gt(ROSA)26Sortm32(CAG−COP4*H134R/EYFP)Hze/J |
The Jackson Laboratory | Stock number 012569 | |
Biological sample (include species here) | Mouse Organotypic Brain Slices | This Paper | ||
Biological sample (include species here) | Mouse Acute Brain Slices | This Paper | ||
Antibody | Anti-Parvalbumin (mouse monoclonal) | Millipore | Cat# MAB1572 RRID:AB_2174013 |
1:500 |
Antibody | Anti-Rhot1 (Miro1) (rabbit polyclonal) | Atlas | Cat# HPA010687 RRID:AB_1079813 |
1:100 |
Antibody | Anti-COX-IV (rabbit polyclonal) | Abcam | Cat# Ab16056 RRID:AB_443304 |
1:500 |
Antibody | Anti-Bassoon (mouse monoclonal) | Abcam | Cat# ab82958 RRID:AB_1860018 |
1:500 |
Antibody | Homer (rabbit polyclonal) | Synaptic Systems | Cat# 160 002 RRID:AB_2120990 |
1:500 |
Antibody | Donkey Anti-Mouse Alexa Fluor 488 | Jackson ImmunoResearch | Cat# 715-545-151 RRID:AB_2341099 |
1:500-1:1000 |
Antibody | Goat Anti-Rabbit Alexa Fluor 555 | Thermo Fisher Scientific | Cat# A-21430 RRID:AB_2535851 |
1:500-1:1000 |
Antibody | Donkey Anti-Rabbit Alexa Fluor 568 | Thermo Fisher Scientific | Cat# A-10042 RRID:AB_2534017 |
1:500-1:1000 |
Antibody | AffiniPure Fab Fragment Goat Anti-Mouse IgG (H+L) | Jackson ImmunoResearch | Cat# 115-007-003 RRID:AB_2338476 |
50 μg/ml |
Sequence-based reagent | Rhot1 Forward: Rhot1_16_F | This paper, López-Doménech et al., 2016, Sigma-Aldrich | PCR Primers | TTAGGATTTGTACTTTGCCCCTG |
Sequence-based reagent | Rhot1 Reverse: Rhot1_16_R | This paper, López-Doménech et al., 2016, Sigma-Aldrich | PCR Primers | AAAACCCTTCCTGCATCACC |
Sequence-based reagent | Cas | This paper, López-Doménech et al., 2016, Sigma-Aldrich | PCR Primers | TCGTGGTATCGTTATGCGCC |
Sequence-based reagent | MitDend WT Forward | This paper, Sigma-Aldrich | PCR Primers | CCAAAGTCGCTCTGAGTTGTTATC |
Sequence-based reagent | MitDend WT Reverse | This paper, Sigma-Aldrich | PCR Primers | GAGCGGGAGAAATGGATATG |
Sequence-based reagent | MitDend Mut Reverse | This paper, Sigma-Aldrich | PCR Primers | TCAATGGGCGGGGGTCGTT |
Sequence-based reagent | Cre Forward | This paper, Sigma-Aldrich | PCR Primers | CACCCTGTTACGTATAGCCG |
Sequence-based reagent | Cre Reverse | This paper, Sigma-Aldrich | PCR Primers | GAGTCATCCTTAGCGCCGTA |
Sequence-based reagent | LacZ_2_small_F | This paper, López-Doménech et al., 2016, Sigma-Aldrich | PCR Primers | ATCACGACGCGCTGTATC |
Sequence-based reagent | LacZ_2_small_R | This paper, López-Doménech et al., 2016, Sigma-Aldrich | PCR Primers | ACATCGGGCAAATAATATCG |
Sequence-based reagent | ChR Forward | This paper, Sigma-Aldrich | PCR Primers | AAGGGAGCTGCAGTGGAGTA |
Sequence-based reagent | ChR Reverse | This paper, Sigma-Aldrich | PCR Primers | CCGAAAATCTGTGGGAAGTC |
Sequence-based reagent | ChR mut Forward | This paper, Sigma-Aldrich | PCR Primers | ACATGGTCCTGCTGGAGTTC |
Sequence-based reagent | ChR mut Reverse | This paper, Sigma-Aldrich | PCR Primers | GGCATTAAAGCAGCGTATCC |
Peptide, recombinant protein | Streptavidin conjugated to Alexa Fluor 555 | Invitrogen | S32355 | 1:500 |
Chemical compound, drug | Carbachol | Sigma Aldrich | 51.83.2 | [5 μM] |
Chemical compound, drug | Biocytin | Sigma Aldrich | B4261 | [3–4 mg/ml] |
Software, algorithm | Fiji | Schindelin et al., 2012 | https://www.fiji.sc/ | |
Software, algorithm | Simple Neurite Tracer | Longair et al., 2011 | https://imagej.net/SNT | |
Software, algorithm | Neuromantic | Myatt et al., 2012 | https://www.reading.ac.uk/neuromantic/body_index.php | |
Software, algorithm | ToxTrac | Rodriguez et al., 2018 | https://sourceforge.net/projects/toxtrac/ | |
Software, algorithm | Matlab_R2015a | Mathworks | https://www.mathworks.com/products/matlab.html | |
Software, algorithm | Prism 6 | Graphpad | https://www.graphpad.com/scientific-software/prism/ | |
Software, algorithm | IgorPro 6.3 | Wavemetrics | https://www.wavemetrics.com/ | |
Other | DAKO mounting media | Agilent Technologies | S3023 | |
Other | Omnipore membrane inserts | Millipore | Cat no. FHLC01300 |