Table 1.
HCV 5ʹ UTR primers and sizes.
| Name | Primer | Base pairs |
|---|---|---|
| OS | 5ʹctcttacgaggcgacactcc3ʹ | 20 |
| OAS | 5ʹcaagcaccctatcaggcagt3ʹ | 20 |
| IS | 5ʹgatcactcccctgtgaggaa3ʹ | 20 |
| IAS | 5ʹctttcgcgacccaacactac3ʹ | 20 |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.