Table 1.
Primer information.
| Gene Symbol | Gene Name (Homo Sapiens) | 5′-Forward Primer-3′ (Length/Tm/%GC) | 5′-Reverse Primer-3′ (Length/Tm/%GC) |
|---|---|---|---|
| MCM2 | Minichromosome maintenance complex component 2 | gtggtactgctatggcggaat (21 bp/59.9 °C/52%GC) |
tgagaggatcattgcctcgc (20 bp/59.4 °C/55%GC) |
| IL-6 | Interleukin 6 | catcctcgacggcatctcag (20 bp/60.32 °C/60%GC) |
tcaccaggcaagtctcctca (20 bp/60.47 °C/55%GC) |
| IL-8 | Interleukin 8 | catactccaaacctttccacc (21 bp/57.9 °C/47,6%GC) |
cttcaaaaacttctccacaacc (22 bp/56.9 °C/40.9%GC) |
| PCNA | Proliferating cell nuclear antigen | tggagaacttggaaatggaaac (22 bp/56.5 °C/40%GC) |
gaactggttcattcatctctatgg (24 bp/59.3 °C/41%GC) |
| CCNA1 | Cyclin A1 | cccaagcaagggtttgacatc (21 bp/59.73 °C, 52%GC) |
taccagcataggggaaactgtg (22 bp/59.76 °C/50%GC) |
| CCND1 | Cyclin D1 | gatgccaacctcctcaacga (20 bp/59.4 °C/55%GC) |
gttcctcgcagacctccag (19 bp/61 °C/63%GC) |
| LCN2/NGAL | Lipocalin-2; Oncogene 24p3; Neutrophil gelatinase-associated lipocalin | ctccacctcagacctgatcc (20 bp/59 °C/60%GC) |
acataccacttcccctggaat (21 bp/59 °C/48%GC) |
| RPL22 | Ribosomal protein L22 | tgattgcacccaccctgtag (20 bp/59.67 °C/55%GC) |
ggttcccagcttttccgttc (20 bp/59.4 °C/55%GC) |
Additional information about the gene function, acc. no., chromosomal location and primer location, amplicon length and location can be found in the Supplementary Data.