Table A1.

Sequence inserts of the positive control plasmids for the Leishmania spp.-specific in-house real-time screening PCRs targeting kinetoplast DNA and the small subunit ribosomal RNA gene.

Positive control plasmid sequence insert for kinetoplast DNA-PCR protocol (GenBank Accession Code: EU437405.1)

CCACCCGGCCCTATTTTACACCAACCCCCAGTTTCCCGCCTCGGACCCGATTTTTGAC-ATTTTTGGCCAATTTTTGAACGGGATTTCTGCACCCATTTTTCGATTTTCGCAGAACGCC-CCTACCCGGAGGACCAGAAAAG

Positive control plasmid sequence insert for the small subunit ribosomal RNA gene-PCR protocol (GenBank Accession Code: M81430.1)

AAGTGCTTTCCCATCGCAACCTCGGTTCGGTGTGTGGCGCCTTTGAGGGGTTTAGTGCGT-C