Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
List of primers used for RT-PCR Analysis.
| Gene | Sequence (5’ -> 3’) Forward Primer | Sequence (5’ -> 3’) Reverse Primer |
|---|---|---|
| Hmox1 | cacgcatatacccgctacct | aaggcggtcttagcctcttc |
| Mt1 | acctcctgcaagaagagctg | aaactgggtggaggtgtacg |
| Scl7a11 | agcagtcccgatctttgttg | aacagctggcagaggagtgt |
| Bdh2 | aaccacagagaacggacctg | gacgatgactttcccttcca |
| Atf5 | agagggcagagtcagtggaa | ggaagtgaaatggagggaca |
