Appendix 1—key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Schizosaccharomyces pombe) | Rng2 | Pombase | SPAC4F8.13c | |
| Gene (Saccharomyces cerevisiae) | Iqg1 | Saccharomyces Genome Database (SGD) | SGD:S000006163 | |
| Strain, strain background (Escherichia coli) | BL21(DE3) | New England Biolabs | C2527I | Chemical competent cells |
| Cell line (Homo sapiens) | Human Embryonic Kidney (HEK) 293T | ATCC | RRID:CVCL_0063 | |
| Cell line (Homo sapiens) | Retinal Pigment Ephitilial-1 (hTERT-RPE1) | ATCC | RRID:CVCL_4388 | |
| Recombinant DNA reagent | pTK93 Lifeact-mCherry | Unpublished (Dr Iain Cheeseman’s lab) | RRID:Addgene46357 | mCherry version of LifeAct peptide |
| Recombinant DNA reagent | pEGFP-IQGAP1 | Ren et al J Biol Chem. 2005 Oct 14. 280(41):34548–57. | RRID:Addgene30112 | EGFP version of Hs IQGAP1 |
| Recombinant DNA reagent | pET28C (+) | Novagen-Sigma Aldrich | Cat. #: 69866 | |
| Recombinant DNA reagent | pGEX-4T1 | Cytiva (GE Healthcare) | Cat. #: 28-9545-49 | |
| Recombinant DNA reagent | pET-3d-6HIS-SNAP-tagged β1 subunit and untagged α1 subunits of chicken CapZ | Bombardier et al., 2015 | RRID:Addgene69948 | SNAP tagged version of Capping proteins |
| Recombinant DNA reagent | pGEX-alpha actinin4 (acnt4) | Bombardier et al., 2015,Ennomani et al., 2016 (Kind gift from Blanchoin’s lab) | 6HIS tagged version of Hsalpha-actinin4 | |
| Recombinant DNA reagent | pET28C-6HIS-Rng2(1-189) | This paper | 6HIS tagged version of SpRng2 (1-189) (Supplementary file 2) | |
| Recombinant DNA reagent | pET28C-6HIS-Rng2(1-250) | This paper | 6HIS tagged version of SpRng2 (1-250) (Supplementary file 2) | |
| Recombinant DNA reagent | pET28C-6HIS-Rng2(1-300) | This paper | 6HIS tagged version of SpRng2 (1-300) (Supplementary file 2) | |
| Recombinant DNA reagent | pETMCN-Rng2(1-189)-C-6HIS | This paper | Cterminal −6HIS tagged version of SpRng2 (1-189) (Supplementary file 2) | |
| Recombinant DNA reagent | pET23a-10HIS-SNAP-Rng2(1-300) | This paper | 10HIS-SNAP tagged version of SpRng2 (1-300) (Supplementary file 2) | |
| Recombinant DNA reagent | pET28C-6HIS-ScIqg1 (1-330) | This paper | 6HIS tagged version of ScIqg1 (1-330) (Supplementary file 2) | |
| Recombinant DNA reagent | pET28C-6HIS-HsIQGAP1 (1–678) | This paper | 6HIS tagged version of HsIQGAP1 (1–678) (Supplementary file 2) | |
| Recombinant DNA reagent | pET28C-6HIS-Cdc12 (740–1391) | This paper | 6HIS tagged version of SpCdc121 (740–1391) (Supplementary file 2) | |
| Recombinant DNA reagent | pETMCN-AScdc8 | Palani et al., 2019, Journal of Cell Biology | untagged version of acetyl mimicking SpCdc8 (Supplementary file 2) | |
| Recombinant DNA reagent | pGEX4T1-GST-Fim1 | This paper | GST tagged version of SpFim1 (Supplementary file 2) | |
| Recombinant DNA reagent | pET23a-10HIS-SNAP-Ezrin-ABD | Unpublished, (Satyajit Mayor’s lab) | 10HIS-SNAP tagged version of Ezrin-ABD (Supplementary file 2) | |
| Recombinant DNA reagent | pCDNA3-EGFP-GSGG-Rng2(1-189) | This paper | EGFP tagged version of SpRng2 (1-189) (Supplementary file 2) | |
| Commercial assay or kit | Gibson cloning (NEBuilder) | New England Biolabs (NEB) | Cat. #: E5520S | |
| Commercial assay or kit | HisPur Ni-NTA agarose resin | ThermoFisher | Cat. #: 88221 | |
| Commercial assay or kit | Glutathione Sepharose 4B | Cytiva (GE healthcare) | Cat. #: 17-0756-01 | |
| Commercial assay or kit | PD MiniTrap G-25 | Cytiva (GE healthcare) | Cat. #: 28918007 | |
| Chemical compound, drug | SNAP-Surface 549 | New England Biolabs (NEB) | Cat. #: S9112S | |
| Chemical compound, drug | SimplyBlue safe Stain | Invitrogen | Cat. #: LC6060 | |
| Other | Opti-MEM | Life Technologies | Cat. #: 31985062 | Reduced Serum Cell medium |
| Chemical compound, drug | Alexa488-maleimide | ThermoFisher | Cat. #: A10254 | |
| Other | poly-prep chromatography columns | Bio-Rad | Cat. #: 7311550 | Column for protein purification |
| Peptide, recombinant protein | Myosin II (Rabbit m. psoas) |
Hypermol | Cat. #: 8326–01 | |
| Other | muscle acetone powder form rabbit | Merck (Sigma-Aldrich) | Cat. #: M6890 | Acetone powder from rabbit muscle used as a source for actin purification |
| Chemical compound, drug | 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC) | Avanti Polar Lipids, RRID:SCR_016391 | Ca.t #: 850375 | |
| Chemical compound, drug | 1,2-dioleoyl-sn-glycero-3-[(N-(5-amino-1-carboxypentyl)iminodiacetic acid)succinyl] (nickel salt) (DGS-NTA(Ni)) | Avanti Polar Lipids, RRID:SCR_016391 | Cat. #: 790404 | |
| Other | Lipid extruder | Avanti Polar Lipids, RRID:SCR_016391 | Cat. #: 610000 | Tool used for the formation of small unilamellar vesicles (SUVs). |
| Other | µ-Dish 35 mm | IBIDI | Cat. #: 81156 | Cell culture dishes with glass bottom made for fluorescence microscopy. |
| Other | 24 mm x50 mm glass coverslips, #1.5, borosilicate | Menzel/ Fisher Scientific | Cat. #: 11348503 | Basis for the formation of lipid bilayers imaged via fluorescence microscopy. |
| Software, algorithm | ImageJ | NIH | RRID:SCR_003070 | Version 1.53 c |
| Primers | ||||
| Sequence-based reagent | SpRng2_1Fw | This paper | PCR primers | CGGGATCCCGATGGACGTAAATGTGGGATTATC |
| Sequence-based reagent | SpRng2_189Rv | This paper | PCR primers | CCGCTCGAGTCATTAAGCTTTGAAGTTAGGAAGGATTAC |
| Sequence-based reagent | SpRng2_250Rv | This paper | PCR primers | CCGCTCGAGTTAGTCTGAACGAGCGCTAGCATC |
| Sequence-based reagent | SpRng2_300Rv | This paper | PCR primers | CCGCTCGAGTCATTAAGATCGTTGCATATGTCCC |
| Sequence-based reagent | ScIqg1-1Fw | This paper | PCR primers | CGGGATCCCGATGACTGCCTACTCCGGTTCC |
| Sequence-based reagent | ScIqg1-330Fw | This paper | PCR primers | CCGCTCGAGTTACACGTCAAGATTGCTCATTTTAGG |
| Sequence-based reagent | SpFim1-Fw | This paper | PCR primers | CGGGATCCCGGATGTTAGCTCTTAAACTTCAAAAG |
| Sequence-based reagent | SpFim1-Rv | This paper | PCR primers | CCGCTCGAGTTATACGGCCATTAAACTGCC |
| Sequence-based reagent | SpCdc12-740Fw | This paper | PCR primers | CGGGATCCCGATGGGCTCAACTAATTCCAAGGAAAGG |
| Sequence-based reagent | SpCdc12-1391Rv | This paper | PCR primers | CCGCTCGAGTTAATTGTTGACAAGATTCAAACGTC |