Skip to main content
. Author manuscript; available in PMC: 2021 Jul 27.
Published in final edited form as: Mol Cell. 2020 Dec 30;81(4):691–707.e6. doi: 10.1016/j.molcel.2020.12.012

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
anti-PDHA1 (phospho S293) Abcam ab92696
anti-PDK1 Cell Signaling Technologies 3062S
anti-FLAG Sigma F1804
anti-Vinculin Sigma V9131
APC-conjugated anti-mouse CD69 BioLegend 10909
eFlour450-conjugated anti-CD3e Thermo Fisher 48-0032-80
anti-mouse CD3e BD Pharmingen 553057
anti-mouse CD28 BD Pharmingen 553294
Chemicals, Peptides, and Recombinant Proteins
AZD7545 Selleck Chemicals S7517
Sodium pyruvate Sigma P2256
Sodium L-lactate Sigma L7022
Duroquinone Sigma D223204
Metformin hydrochloride Sigma PHR1084
FCCP (carbonyl cyanide 4-(trifluoromethoxy)phenylhydrazone) Sigma C2920
Rotenone Sigma R8875
Oligomycin A Sigma 75351
Antimycin A Sigma A8674
Gramicidin from Bacillus aneurinolyticus (Bacillus brevis) Sigma G5002
TMRE (tetramethylrhodamine, ethyl ester) Thermo Fisher T669
Critical Commercial Assays
NAD/NADH-Glo Assay kit Promega G9072
ADP/ATP Ratio Assay Kit Sigma MAK135
TMRE (tetramethylrhodamine, ethyl ester) assay kit Abcam ab113852
Ethanol Assay Kit Sigma MAK076
Dynabeads Untouched Human CD4 T Cells kit Thermo Fisher 11346D
Pan-T cell isolation kit Miltenyl Biotec 130-095-130
Deposited Data
Raw image data This manuscript http://dx.doi.org/10.17632/6zpghspxgs.1.
Experimental Models: Cell Lines
Human: 143B ATCC CRL-8303
Human: A172 ATCC CRL-1620
Human: A549 ATCC CCL-185
Mouse: C2C12 ATCC CRL-1772
Human: H1299 ATCC CRL-5803
Human: HeLa ATCC CCL-2
Human: MDA-MB-231 ATCC HTB-26
Mouse: PSC This manuscript N/A
Human: Primary CD4+ T cells This manuscript N/A
Mouse: Primary T cells This manuscript N/A
Experimental Models: Organisms/Strains
Mouse: NU/NU Nude Mouse (Crl:NU-Foxn1nu) Charles River 088
S. cerevisiae: CEN.PK 5D (MATa ura3–52 HIS3, LEU2 TRP1 MAL2–8c SUC2) This manuscript N/A
Oligonucleotides
sgRNA sequence targeting PDK1 #1 (5’ GCTCACGTACCACTCGGCAG 3’) Horlbeck et al., 2016 hCRISPRi-v2.1
sgRNA sequence targeting PDK1 #2 (5’ GACGTCCCTCACGTACCACT 3’ Horlbeck et al., 2016 hCRISPRi-v2.1
sgRNA sequence non-targeting control (5’ GGGAACCACATGGAATTCGA 3’) Horlbeck et al., 2016 hCRISPRi-v2.1
Recombinant DNA
pUC57-LbNOX Addgene 75285
pInducer20 Addgene 44012
Software and Algorithms
FlowJo FlowJo V10.6.1
Xcalibur™ Software Thermo Fisher N/A
Prism GraphPad 8.2.1