Antibodies |
anti-PDHA1 (phospho S293) |
Abcam |
ab92696 |
anti-PDK1 |
Cell Signaling Technologies |
3062S |
anti-FLAG |
Sigma |
F1804 |
anti-Vinculin |
Sigma |
V9131 |
APC-conjugated anti-mouse CD69 |
BioLegend |
10909 |
eFlour450-conjugated anti-CD3e |
Thermo Fisher |
48-0032-80 |
anti-mouse CD3e |
BD Pharmingen |
553057 |
anti-mouse CD28 |
BD Pharmingen |
553294 |
Chemicals, Peptides, and Recombinant Proteins |
AZD7545 |
Selleck Chemicals |
S7517 |
Sodium pyruvate |
Sigma |
P2256 |
Sodium L-lactate |
Sigma |
L7022 |
Duroquinone |
Sigma |
D223204 |
Metformin hydrochloride |
Sigma |
PHR1084 |
FCCP (carbonyl cyanide 4-(trifluoromethoxy)phenylhydrazone) |
Sigma |
C2920 |
Rotenone |
Sigma |
R8875 |
Oligomycin A |
Sigma |
75351 |
Antimycin A |
Sigma |
A8674 |
Gramicidin from Bacillus aneurinolyticus (Bacillus brevis)
|
Sigma |
G5002 |
TMRE (tetramethylrhodamine, ethyl ester) |
Thermo Fisher |
T669 |
Critical Commercial Assays |
NAD/NADH-Glo Assay kit |
Promega |
G9072 |
ADP/ATP Ratio Assay Kit |
Sigma |
MAK135 |
TMRE (tetramethylrhodamine, ethyl ester) assay kit |
Abcam |
ab113852 |
Ethanol Assay Kit |
Sigma |
MAK076 |
Dynabeads Untouched Human CD4 T Cells kit |
Thermo Fisher |
11346D |
Pan-T cell isolation kit |
Miltenyl Biotec |
130-095-130 |
Deposited Data |
Raw image data |
This manuscript |
http://dx.doi.org/10.17632/6zpghspxgs.1. |
Experimental Models: Cell Lines |
Human: 143B |
ATCC |
CRL-8303 |
Human: A172 |
ATCC |
CRL-1620 |
Human: A549 |
ATCC |
CCL-185 |
Mouse: C2C12 |
ATCC |
CRL-1772 |
Human: H1299 |
ATCC |
CRL-5803 |
Human: HeLa |
ATCC |
CCL-2 |
Human: MDA-MB-231 |
ATCC |
HTB-26 |
Mouse: PSC |
This manuscript |
N/A |
Human: Primary CD4+ T cells |
This manuscript |
N/A |
Mouse: Primary T cells |
This manuscript |
N/A |
Experimental Models: Organisms/Strains |
Mouse: NU/NU Nude Mouse (Crl:NU-Foxn1nu)
|
Charles River |
088 |
S. cerevisiae: CEN.PK 5D (MATa ura3–52 HIS3, LEU2 TRP1 MAL2–8c SUC2) |
This manuscript |
N/A |
Oligonucleotides |
sgRNA sequence targeting PDK1 #1 (5’ GCTCACGTACCACTCGGCAG 3’) |
Horlbeck et al., 2016 |
hCRISPRi-v2.1 |
sgRNA sequence targeting PDK1 #2 (5’ GACGTCCCTCACGTACCACT 3’ |
Horlbeck et al., 2016 |
hCRISPRi-v2.1 |
sgRNA sequence non-targeting control (5’ GGGAACCACATGGAATTCGA 3’) |
Horlbeck et al., 2016 |
hCRISPRi-v2.1 |
Recombinant DNA |
pUC57-LbNOX |
Addgene |
75285 |
pInducer20 |
Addgene |
44012 |
Software and Algorithms |
FlowJo |
FlowJo |
V10.6.1 |
Xcalibur™ Software |
Thermo Fisher |
N/A |
Prism |
GraphPad |
8.2.1 |