Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Staphylococcus aureus) | GloB | GenBank | WP_001223008.1 | GloII |
| Gene (Staphylococcus aureus) | FrmB | GenBank | estA | |
| Strain, strain background (Staphylococcus aureus) | JE2 | BEI Resources | NR-46543 | |
| Strain, strain background (Staphylococcus aureus) | NE64 | Nebraska Transposon Mutant Library | Hypothetical protein | Available from BEI Resources as: NR-48501 |
| Strain, strain background (Staphylococcus aureus) | NE145 | Nebraska Transposon Mutant Library | protoporphyrinogen oxidase | Available from BEI Resources as: NR-48501 |
| Strain, strain background (Staphylococcus aureus) | NE202 | Nebraska Transposon Mutant Library | ABC transporter, ATP-binding protein, MsbA family | Available from BEI Resources as: NR-48501 |
| Strain, strain background (Staphylococcus aureus) | NE223 | Nebraska Transposon Mutant Library | hydroxyacylglutathione hydrolase | Available from BEI Resources as: NR-48501 |
| Strain, strain background (Staphylococcus aureus) | NE293 | Nebraska Transposon Mutant Library | staphylococcal accessory regulator Rot | Available from BEI Resources as: NR-48501 |
| Strain, strain background (Staphylococcus aureus) | NE355 | Nebraska Transposon Mutant Library | tributyrin esterase | Available from BEI Resources as: NR-48501 |
| Strain, strain background (Staphylococcus aureus) | NE364 | Nebraska Transposon Mutant Library | NAD-dependent epimerase/dehydratase family protein | Available from BEI Resources as: NR-48501 |
| Strain, strain background (Staphylococcus aureus) | NE377 | Nebraska Transposon Mutant Library | pyrroline-5-carboxylate reductase | Available from BEI Resources as: NR-48501 |
| Strain, strain background (Staphylococcus aureus) | NE386 | Nebraska Transposon Mutant Library | Hypothetical protein | Available from BEI Resources as: NR-48501 |
| Strain, strain background (Staphylococcus aureus) | NE478 | Nebraska Transposon Mutant Library | peptide ABC transporter, permease protein | Available from BEI Resources as: NR-48501 |
| Strain, strain background (Staphylococcus aureus) | NE503 | Nebraska Transposon Mutant Library | conserved hypothetical protein | Available from BEI Resources as: NR-48501 |
| Strain, strain background (Staphylococcus aureus) | NE520 | Nebraska Transposon Mutant Library | sensor histidine kinase SaeS | Available from BEI Resources as: NR-48501 |
| Strain, strain background (Staphylococcus aureus) | NE532 | Nebraska Transposon Mutant Library | PTS system, mannitol specific IIBC component | Available from BEI Resources as: NR-48501 |
| Strain, strain background (Staphylococcus aureus) | NE541 | Nebraska Transposon Mutant Library | alkaline phosphatase synthesis transcriptional regulatory protein | Available from BEI Resources as: NR-48501 |
| Strain, strain background (Staphylococcus aureus) | NE621 | Nebraska Transposon Mutant Library | Hypothetical protein | Available from BEI Resources as: NR-48501 |
| Strain, strain background (Staphylococcus aureus) | NE812 | Nebraska Transposon Mutant Library | tetrahydrodipicolinate acetyltransferase | Available from BEI Resources as: NR-48501 |
| Strain, strain background (Staphylococcus aureus) | NE874 | Nebraska Transposon Mutant Library | Hypothetical protein | Available from BEI Resources as: NR-48501 |
| Strain, strain background (Staphylococcus aureus) | NE929 | Nebraska Transposon Mutant Library | acetyl-CoA carboxylase, biotin carboxylase | Available from BEI Resources as: NR-48501 |
| Strain, strain background (Staphylococcus aureus) | NE937 | Nebraska Transposon Mutant Library | tandem lipoprotein | Available from BEI Resources as: NR-48501 |
| Strain, strain background (Staphylococcus aureus) | NE949 | Nebraska Transposon Mutant Library | Putative Transposase | Available from BEI Resources as: NR-48501 |
| Strain, strain background (Staphylococcus aureus) | NE1039 | Nebraska Transposon Mutant Library | excinuclease ABC, A subunit | Available from BEI Resources as: NR-48501 |
| Strain, strain background (Staphylococcus aureus) | NE1051 | Nebraska Transposon Mutant Library | Hypothetical protein | Available from BEI Resources as: NR-48501 |
| Strain, strain background (Staphylococcus aureus) | NE1071 | Nebraska Transposon Mutant Library | Hypothetical protein | Available from BEI Resources as: NR-48501 |
| Strain, strain background (Staphylococcus aureus) | NE1118 | Nebraska Transposon Mutant Library | dihydrolipoamide dehydrogenase | Available from BEI Resources as: NR-48501 |
| Strain, strain background (Staphylococcus aureus) | NE1127 | Nebraska Transposon Mutant Library | gamma-hemolysin component B | Available from BEI Resources as: NR-48501 |
| Strain, strain background (Staphylococcus aureus) | NE1173 | Nebraska Transposon Mutant Library | tRNA pseudouridine synthase A | Available from BEI Resources as: NR-48501 |
| Strain, strain background (Staphylococcus aureus) | NE1225 | Nebraska Transposon Mutant Library | ABC transporter, ATP-binding protein | Available from BEI Resources as: NR-48501 |
| Strain, strain background (Staphylococcus aureus) | NE1238 | Nebraska Transposon Mutant Library | transcriptional regulator, TetR family | Available from BEI Resources as: NR-48501 |
| Strain, strain background (Staphylococcus aureus) | NE1283 | Nebraska Transposon Mutant Library | Hypothetical protein | Available from BEI Resources as: NR-48501 |
| Strain, strain background (Staphylococcus aureus) | NE1296 | Nebraska Transposon Mutant Library | hydroxyacylglutathione hydrolase | Available from BEI Resources as: NR-48501 |
| Strain, strain background (Staphylococcus aureus) | NE1486 | Nebraska Transposon Mutant Library | phosphonate ABC transporter, permease protein | Available from BEI Resources as: NR-48501 |
| Strain, strain background (Staphylococcus aureus) | NE1505 | Nebraska Transposon Mutant Library | tributyrin esterase | Available from BEI Resources as: NR-48501 |
| Strain, strain background (Staphylococcus aureus) | NE1519 | Nebraska Transposon Mutant Library | Hypothetical Alkaline Phosphatase | Available from BEI Resources as: NR-48501 |
| Strain, strain background (Staphylococcus aureus) | NE1547 | Nebraska Transposon Mutant Library | Hypothetical protein | Available from BEI Resources as: NR-48501 |
| Strain, strain background (Staphylococcus aureus) | NE1610 | Nebraska Transposon Mutant Library | Hypothetical protein | Available from BEI Resources as: NR-48501 |
| Strain, strain background (Staphylococcus aureus) | NE1682 | Nebraska Transposon Mutant Library | PfkB family kinase | Available from BEI Resources as: NR-48501 |
| Strain, strain background (Staphylococcus aureus) | NE1723 | Nebraska Transposon Mutant Library | type I restriction-modification system, M subunit | Available from BEI Resources as: NR-48501 |
| Strain, strain background (Escherichia coli) | BL21 (DE3) | Sigma | CMC0014 | Chemically Competent |
| Biological sample (Homo sapiens) | Fresh Human Serum | This paper | Whole blood was collected from a willing volunteer into untreated BD vacutainer tubes (BD, BD366430), allowed to clot, and aggregates were removed via centrifugation | |
| Biological sample (Homo sapiens) | Lyophilized Human Serum | Rockland Inc | D314-5 | |
| Biological sample (Mus musculus) | Lyophilized Mouse Serum | Rockland Inc | D308-5 | |
| Recombinant DNA reagent | pET28a-SaFrmB | This paper | E. coli expression plasmid for SaFrmB with cleavable HIS tag. | |
| Recombinant DNA reagent | pET28a-SaGloB | This paper | E. coli expression plasmid for SaGloB with cleavable HIS tag. | |
| Recombinant DNA reagent | BG1861-SaGloB | This paper | E. coli expression plasmid for SaGloB with HIS tag. | |
| Recombinant DNA reagent | BG1861-SaFrmB | This paper | E. coli expression plasmid for SaFrmB with HIS tag. | |
| Sequence-based reagent | NWMN_0144_F | This paper | PCR Primer | TTTTCCTGATCCTGATTCAC |
| Sequence-based reagent | NWMN_0144_R | This paper | PCR Primer | ATGATGCTTCCATGTTTGTT |
| Sequence-based reagent | NWMN_0306_F | This paper | PCR Primer | AATACACCGGGTAACACAAC |
| Sequence-based reagent | NWMN_0306_R | This Paper | PCR Primer | CGTTTTGTTGAGCTAATTCC |
| Sequence-based reagent | NWMN_0309_F | This paper | PCR Primer | ACCATGCTTAAAGGGATTTT |
| Sequence-based reagent | NWMN_0309_R | This Paper | PCR Primer | TGTCACCTAAGTCAACACCA |
| Sequence-based reagent | NWMN_0407 (lpl4nm) _F | This paper | PCR Primer | CCGTTGGAGATAGGAAGTTA |
| Sequence-based reagent | NWMN_0407 (lpl4nm) _R | This paper | PCR Primer | TTTGTGCTTCTTTTGAACCT |
| Sequence-based reagent | NWMN_0654_F | This paper | PCR Primer | GAAAATGGAAGACTGATTGC |
| Sequence-based reagent | NWMN_0654_R | This paper | PCR Primer | TAATGCATCTGACAAAGTCG |
| Sequence-based reagent | NWMN_0762_F | This paper | PCR Primer | GGTGAAGTTTTGGACGATAA |
| Sequence-based reagent | NWMN_0762_R | This paper | PCR Primer | TTTTCATCTGTCCGACTTTT |
| Sequence-based reagent | NWMN_1101_F | This paper | PCR Primer | TCCACCTATTGGAATTATCG |
| Sequence-based reagent | NWMN_1101_R | This paper | PCR Primer | AGACGTTCAATTTCAGTGCT |
| Sequence-based reagent | NWMN_1192 (pgsA) _F | This paper | PCR Primer | TGGGACGAAGTAATTACAGTT |
| Sequence-based reagent | NWMN_1192 (pgsA) _R | This paper | PCR Primer | ATATCCCCCTTGTATCGTTT |
| Sequence-based reagent | NWMN_1308 (dapD) _F | This paper | PCR Primer | TCTATTCGTGGAGGTACGAT |
| Sequence-based reagent | NWMN_1308 (dapD) _R | This paper | PCR Primer | ATCGTATGTGAGCCATTACC |
| Sequence-based reagent | NWMN_1410_F | This paper | PCR Primer | CGATAAACCTAAACCACTCG |
| Sequence-based reagent | NWMN_1410_R | This paper | PCR Primer | ATAAACAATGCTTGCCAAAT |
| Sequence-based reagent | NWMN_1505_F | This paper | PCR Primer | TGAAGGTGAATTAAGCGATG |
| Sequence-based reagent | NWMN_1505_R | This paper | PCR Primer | TGCTATTCCCAATTTGTTCA |
| Sequence-based reagent | NWMN_1655_F | This paper | PCR Primer | GAATTGTTGCAATTTAATGGT |
| Sequence-based reagent | NWMN_1655_R | This paper | PCR Primer | AACGTAATCATGCTCCATTC |
| Sequence-based reagent | NWMN_1679_F | This paper | PCR Primer | CCATGGGAAAAATTAGACAA |
| Sequence-based reagent | NWMN_1679_R | This paper | PCR Primer | AAATATCGCCTCACCTTTTT |
| Sequence-based reagent | NWMN_1723 (hemY) _F | This paper | PCR Primer | GCCGAATACACATCCATTAT |
| Sequence-based reagent | NWMN_1723 (hemY) _R | This paper | PCR Primer | AACCTTTGTCTCTGCTTCAA |
| Sequence-based reagent | NWMN_1851 (nadC) _F | This paper | PCR Primer | AGCCATTTTAGCACCATAAA |
| Sequence-based reagent | NWMN_1851 (nadC)_R | This paper | PCR Primer | TAGAATCCTGTCCTCCTGAA |
| Sequence-based reagent | NWMN_2057 (mtlF)_F | This paper | PCR Primer | TGTACAACGGTGTTGTTTTG |
| Sequence-based reagent | NWMN_2057 (mtlF)_R | This paper | PCR Primer | CGGTGAATAGTACGAGAGGA |
| Sequence-based reagent | NWMN_2528_F | This paper | PCR Primer | ACTGATGCTTTACCAGAAAC |
| Sequence-based reagent | NWMN_2528_R | This paper | PCR Primer | TCAGCGGTAGTAATAAAGGT |
| Chemical compound, drug | POM-HEX | White et al., 2018 | ||
| Chemical compound, drug | Hemi-HEX | Lin et al., 2020 | ||
| Chemical compound, drug | HEX | Lin et al. 2018 | ||
| Chemical compound, drug | Fluorescent Prosubstrates | White et al., 2018 | ||
| Chemical compound, drug | S-D-lactoylglutathione | Sigma-Aldrich | L7140 | |
| Chemical compound, drug | 4-Nitrophenyl acetate | Sigma-Aldrich | N8130 | |
| Chemical compound, drug | 4-Nitrophenyl butyrate | Sigma-Aldrich | N9876 | |
| Chemical compound, drug | 4-Nitrophenyl trimethyl acetate | Sigma-Aldrich | 135046 | |
| Software, algorithm | WhatsGNU | Moustafa and Planet, 2020 | https://github.com/ahmedmagds/WhatsGNU | |
| Software, algorithm | MUSCLE | Letunic and Bork, 2019 | https://www.ebi.ac.uk/Tools/msa/muscle/ | |
| Software, algorithm | iTOL | Madeira et al., 2019 | https://itol.embl.de/ | |
| Software, algorithm | HKL-3000 | Minor et al., 2006 | https://hkl-xray.com/hkl-3000 | |
| Software, algorithm | PHASER | McCoy et al., 2007 | ||
| Software, algorithm | COOT | Emsley and Cowtan, 2004 | https://www2.mrc-lmb.cam.ac.uk/personal/pemsley/coot/ | |
| Software, algorithm | PHENIX | Adams et al., 2010 | http://www.phenix-online.org/ | |
| Software, algorithm | ChemDraw3D | https://www.cambridgesoft.com/Ensemble_for_Chemistry/details/Default.aspx?fid=13&pid=668 | ||
| Software, algorithm | AutoDock Tools 1.5.7 | Morris et al., 2009 | http://autodock.scripps.edu/resources/adt | |
| Software, algorithm | AutoDock Vina | Trott and Olson, 2010 | http://vina.scripps.edu/ | |
| Software, algorithm | GraphPad Prism | https://www.graphpad.com/scientific-software/prism/ | ||
| Other | CellASIC ONIX2 microfluidic plate | EMD-Millipore | B04A-03-5PK |