REAGENT or RESOURCE | SOURCE | IDENTIFIER |
---|---|---|
Antibodies | ||
CD11c-PE/Cy7 (Bu15) | BioLegend | Cat#: 337216 RRID: AB_2129790 |
CD123-FITC (6H6) | BioLegend | Cat#: 306014 RRID: AB_2124259 |
CD14-APC/Cy7 (HCD14) | BioLegend | Cat#: 325620 RRID: AB_830693 |
CD19-BUV737 (SJ25C1) | BD | Cat#: 564303 RRID: AB_2716867 |
CD3-BUV737 (UCHT1) | BD | Cat#: 564307 RRID: AB_2744390 |
CD56-BUV395 (NCAM16.2) | BD | Cat#: 563554 RRID: AB_2687886 |
HLA-DR-BV605 (L243) | BioLegend | Cat#: 307640 RRID: AB_2561913 |
Biological samples | ||
Human blood | Healthy individuals from the University Medical Center Hamburg-Eppendorf | Cat#: N/A |
Chemicals, peptides, and recombinant proteins | ||
DNA Suspension Buffer, pH 8.0, DNase/RNase Tested, PCR Grade | Teknova | Cat#: T0221 |
Sso Fast EvaGreen Supermix with Low ROX | Bio-Rad | Cat#: 1725210 |
Fast Probe Master Mix | Biotium | Cat#: 31005 |
Aqua ad iniectabilia (DNA-free water) | Braun | Cat#: 235 1744 |
ACK Lysing Buffer | Lonza | Cat#: 10-548E |
Biocoll-Trennlösung | Biochrom | Cat#: L6115 |
Dulbecco’s Phosphate Buffered Saline (PBS) | Sigma-Aldrich | Cat#: D8537 |
Dymethyl sulfoxide (DMSO) | Sigma-Aldrich | Cat#: D5879-100ML |
Fetal bovine serum (FBS) superior | Biochrom | Cat#: S0615 |
ROX Reference Dye | Thermo Fisher Scientific | Cat#: 12223012 |
RPMI-1640 Medium | Life Technologies | Cat#: 21875091 |
Critical commercial assays | ||
C1 Single-Cell Reagent Kit for Preamp | Fluidigm | Cat#: 100-5319 |
DNeasy Blood & Tissue Kit (250) | QIAGEN GmbH | Cat#: 69506 |
GE 96.96 Dynamic Array™ DNA Binding Dye Sample & Assay Loading Reagent Kit with Control Line Fluid | Fluidigm | Cat#: 100-3415 |
QIAGEN Multiplex PCR Kit | QIAGEN | Cat#: 206143 |
Plasmacytoid Dendritic Cell Isolation Kit II, human | Miltenyi Biotec | Cat#: 130-097-415 |
Single Cell-to-CT qRT-PCR Kit | Thermo Fisher Scientific | Cat#: 4458237 |
SNP Type™ 192.24 Genotyping Reagent Kit with Control Line Fluid | Fluidigm | Cat#: 100-4136 |
Zombie Aqua™ Fixable Viability Kit | BioLegend | Cat#: 423102 |
Oligonucleotides | ||
CYBB - pre-amplification – forward primer AAGGAAATTTTCCAGATCATTAGGACA |
This paper | N/A |
CYBB - pre-amplification – reverse primer CCCAGTTACCCTGCTGTATTAGTA |
This paper | N/A |
CYBB – quantitative PCR – forward primer GAGAGTGTCTCAACACTTATTAGTGAC |
This paper | N/A |
CYBB – quantitative PCR – reverse primer CCCAGTTACCCTGCTGTATTAGTA |
This paper | N/A |
CYBB - SNP typing (rs5964151) - forward primers ACATGTTGAGAGTGTCTCAACACTTAT ACATGTTGAGAGTGTCTCAACACTTAG |
This paper | N/A |
CYBB - SNP typing (rs5964151) - reverse primer GGAGTATGCTCAGATGTCAATACTGTCA |
This paper | N/A |
B2M - pre-amplification + quantitative PCR – forward primer TTAGCTGTGCTCGCGCTAC |
This paper | N/A |
B2M - pre-amplification + quantitative PCR – reverse primer CTCTGCTGGATGACGTGAGTAA |
This paper | N/A |
IRF2BP2 - pre-amplification + quantitative PCR – forward primer GGCCCTTCGAGAGCAAGTTTAA |
This paper | N/A |
IRF2BP2 - pre-amplification + quantitative PCR – reverse primer TGGTTCTGGAGAGGGCTTCC |
This paper | N/A |
TLR7 - pre-amplification – forward primer TGGGCACCACACAGGT |
This paper | N/A |
TLR7 - pre-amplification – reverse primer CTGTTTCCCTATGGAACCCAGAA |
This paper | N/A |
TLR7 - quantitative PCR – forward primer ACAGGTGGTTGCTGCTTCA |
This paper | N/A |
TLR7 - quantitative PCR – reverse primer CTGTTTCCCTATGGAACCCAGAA |
This paper | N/A |
TLR7 - SNP typing (rs3853839) – forward primers CTTCAGTGCTTCCTGCTCTTTTTC CTTCAGTGCTTCCTGCTCTTTTTG |
This paper | N/A |
TLR7 - SNP typing (rs3853839) – reverse primer CTATGGAACCCAGAAGCAGGC |
This paper | N/A |
Software and algorithms | ||
CLC Main Workbench, version 7.9.1 | QIAGEN Aarhus A/S | https://digitalinsights.qiagen.com/ |
FlowJo10 | FlowJo LLC | http://www.flowjo.com |
Fluidigm Real-Time PCR Analysis, version 4.3.1 | Fluidigm | https://www.fluidigm.com/ |
Fluidigm SNP Genotyping Analysis; version 4.3.2 | Fluidigm | https://www.fluidigm.com/ |
GraphPad Prism 9 | GraphPad Software, LLC | https://www.graphpad.com/ |
Microsoft PowerPoint 2016 | Microsoft | https://www.microsoft.com |
Other | ||
192.24 Dynamic Array™ IFC for SNP Genotyping | Fluidigm | BMK-M-192.24GT |
48.48 Dynamic Array™ IFC for Genotyping | Fluidigm | BMK-M-48.48GT |
96.96 Dynamic Array™ IFC for Gene Expression | Fluidigm | BMK-M-96.96 |
C1™ Single-Cell Preamp IFC, 5–10 μm | Fluidigm | 100-5757 |
qPCR foil | SARSTEDT | 95.1994 |
PCR plate half skirt, 96 well | SARSTEDT | 72.1979.102 |
Sterican single-use cannula, blunt (Ø 0.8 × 22 mm) | Braun | 918 0109 |
8-Channel pipette (0.5 μL–10 μL) | Rainin | 17013802 |
8-Channel pipette (5 μL–50 μL) | Rainin | 17013804 |
C1 | Fluidigm | N/A |
Biomark HD | Fluidigm | N/A |
Juno | Fluidigm | N/A |
Fluorescence-activated cell sorter (FACS), e.g., FACSAria Fusion | BD | N/A |
Microscope with 20× and 40× magnification | N/A | N/A |
NanoDrop | N/A | N/A |