Skip to main content
. 2021 Jul 16;11:693360. doi: 10.3389/fonc.2021.693360

Table 1.

Differentially expressed exosomal microRNAs identified by next generation sequencing.

miRNA Information Statistics & Regulation
Source Mature-miRNA sequence Fold Change P-value Regulation
Serum hsa-miR-130b-3p CAGUGCAAUGAUGAAAGGGCAU 4.555389982 0.036615174 Up
Serum hsa-miR-143-3p UGAGAUGAAGCACUGUAGCUC -2.481915254 0.043638531 Down
Serum hsa-miR-151a-3p CUAGACUGAAGCUCCUUGAGG 2.545806244 0.013604136 Up
Serum hsa-miR-15b-3p CGAAUCAUUAUUUGCUGCUCUA 5.095125215 0.016185555 Up
Serum hsa-miR-194-5p UGUAACAGCAACUCCAUGUGGA -2.508236592 0.046425407 Down
Serum hsa-miR-196b-5p UAGGUAGUUUCCUGUUGUUGGG -4.002942023 0.038692865 Down
Serum hsa-miR-22-5p AGUUCUUCAGUGGCAAGCUUUA -5.970168823 0.034517425 Down
Serum hsa-miR-6087 UGAGGCGGGGGGGCGAGC -2.154113907 0.019948851 Down
Urine hsa-miR-1246 AAUGGAUUUUUGGAGCAGG 5.747077844 0.043731253 Up
Urine hsa-miR-139-5p UCUACAGUGCACGUGUCUCCAGU -6.184723327 0.025724708 Down
Urine hsa-miR-345-5p GCUGACUCCUAGUCCAGGGCUC -7.376130587 0.021140159 Down

Fold change, Fold change between two groups; P-value, P-value is calculated by paired t-test; Regulation, ‘up’ indicates up-regulation, and ‘down’ indicates down-regulation.