Table 1.

The Genes, SNP Reference Sequence (rs) and Their Synonyms, Exon where the SNPs are Located and the Sequences of the Primers and Their Sources

The gene	SNP rs ID	Exon	Forward primers	Reverse primers	Reference of the source of the primers
CYP1A1	rs1048943 (VAR_001243, rs386513458, rs52810784, rs3188998, rs17861092 )	7	5′CCACTCACTTGACACTTCTGAGCCC 3′	5′AAAGACCTCCCAGCGGGCCA 3′	(Ding et al., 2017)
CYP1A1	rs4646903(rs17861083, rs5030838, rs116877783)	Un-translated	5’-CAGTGAAGAGGTGTAGCCGC-3’	5’-TAGGAGTCTTGTCTCATGCC3’	(Vijayalakshmi et al., 2005)
CYP1B1	rs1056836	3	5`CACCACTGCCAACACCTCTGTC3	5'-AGTTCTCCGGGTTAGGCCACTTAA-3	(Gehan A. El-Shennawy and Elbehery, 2010)