KEY RESOURCES TABLE.
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| TotalSeq-C0072 anti-human CD4 Antibody | Biolegend | Cat# 300567; RRID:AB_2800725 |
| TotalSeq-C0386 anti-human CD28 Antibody | Biolegend | Cat# 302963; RRID:AB_2800751 |
| TotalSeq-C0063 anti-human CD45RA Antibody | Biolegend | Cat# 304163; RRID:AB_2800764 |
| TotalSeq-C0049 anti-human CD3 Antibody | Biolegend | Cat# 344849; RRID:AB_2814272 |
| rat monoclonal anti-CD3 | Abcam | Cat# ab11089; RRID:AB_2889189 |
| rabbit polyclonal anti-CD28 | Sigma | Cat# HPA070003; RRID:AB_2686226 |
| rabbit monoclonal anti-CD86 | Cell Signaling | Cat# 91882S; RRID:AB_2797422 |
| mouse monoclonal anti-CD80 | R&D Systems | Cat# MAB140; RRID:AB_2244549 |
| mouse monoclonal anti-CD207 | Novocastra / Leica | Cat# NCL-L-Langerin; RRID:AB_563850 |
| rabbit polyclonal anti-CD207 | Sigma | Cat# HPA011216; RRID:AB_1078453 |
| Cy3-conjugated goat anti-Rat IgG (H+L) | Jackson Immunoresearch | Cat# 112-165-003; RRID:AB_2338240 |
| Alexa Fluor® 488-conjugated goat anti-rat IgG (H+L) | Thermo Fisher Scientific | Cat# A11006; RRID:AB_2534074 |
| Alexa Fluor®488-conjugated goat anti-rabbit IgG (H+L) | Thermo Fisher Scientific | Cat# A11008; RRID:AB_143165 |
| Alexa Fluor® 488-conjugated goat anti-mouse IgG1 | Thermo Fisher Scientific | Cat# A21121; RRID:AB_2535764 |
| Alexa Fluor® 647-conjugated donkey anti-mouse IgG (H+L) | Jackson Immunoresearch | Cat# 715-605-150; RRID:AB_2340862 |
| Alexa Fluor® 594-conjugated donkey anti-rabbit IgG (H+L) | Jackson Immunoresearch | Cat# 711-585-152; RRID:AB_2340621 |
| Anti-FLAG M2 antibody-conjugated agarose beads | Sigma-Aldrich | Cat# A2220; RRID:AB_10063035 |
| Anti-FLAG M2 antibody | Sigma-Aldrich | Cat# F1804; RRID:AB_262044 |
| Brilliant Violet 421 anti-human CD197 (CCR7) Antibody | Biolegend | Cat# 353208; RRID:AB_11203894 |
| APC/Cyanine7 anti-human CD1c Antibody | Biolegend | Cat# 331520; RRID:AB_10644008 |
| BV786 Mouse Anti-Human CD3 Clone UCHT1 | BD Biosciences | Cat# 565491; RRID:AB_2739260 |
| FITC Mouse Anti-Human CD3 Clone UCHT1 | BD Biosciences | Cat# 555916; RRID:AB_396217 |
| CD3-VioBlue, human monoclonal (BW264/56) | Miltenyi Biotec | Cat# 130-094-363; RRID:AB_10831672 |
| CD3d Monoclonal Antibody (7D6), PE | Thermo Fisher Scientific | Cat# MHCD0304; RRID:AB_10376004 |
| CD3 Monoclonal Antibody (OKT3), Functional Grade, eBioscience | Thermo Fisher Scientific | Cat# 16-0037-85; RRID:AB_468855 |
| BV711 Mouse Anti-Human CD4 Clone RPA-T4 | BD Biosciences | Cat# 740769; RRID:AB_2740432 |
| CD4 Antibody, anti-human, APC-Vio 770 (M-T321) | Miltenyi Biotec | Cat# 130-100-355; RRID:AB_2657995 |
| BV650 Mouse Anti-Human CD8 Clone RPA-T8 | BD Biosciences | Cat# 563821; RRID:AB_2744462 |
| CD8 (BW135/80)-FITC, human (clone: BW135/80) | Miltenyi Biotec | Cat# 130-080-601; RRID:AB_244336 |
| PE Mouse Anti-Human CD4 Clone RPA-T4 | BD Biosciences | Cat# 555347; RRID:AB_395752 |
| CD11c APC Clone S-HCL-3 | BD Biosciences | Cat# 333144; RRID:AB_2868645 |
| FITC Mouse Anti-Human CD14 Clone M5E2 | BD Biosciences | Cat# 555397; RRID:AB_395798 |
| FITC Mouse Anti-Human CD16 Clone 3G8 | BD Biosciences | Cat# 555406; RRID:AB_395806 |
| FITC Mouse Anti-Human CD19 Clone 4G7 | BD Biosciences | Cat# 345776; RRID:AB_2868804 |
| APC-H7 Mouse Anti-Human CD19 Clone HIB19 | BD Biosciences | Cat# 560727; RRID:AB_1727437 |
| CD20 Antibody, anti-human, FITC | Miltenyi Biotec | Cat# 130-091-108; RRID:AB_244317 |
| FITC Mouse anti-Human CD56 Clone B159 | BD Biosciences | Cat# 562794; RRID:AB_2737799 |
| BV421 Mouse Anti-Human CD25 Clone M-A251 | BD Biosciences | Cat# 562442; RRID:AB_11154578 |
| Brilliant Violet 421 anti-human CD27 | Sony | Cat# 2114120 |
| FITC Mouse Anti-Human CD27 Clone L128 | BD Biosciences | Cat# 340424; RRID:AB_400031 |
| CD28 Antibody, anti-human, APC | Miltenyi Biotec | Cat# 130-092-923; RRID:AB_871654 |
| PE Mouse Anti-Human CD28 Clone CD28.2 | BD Biosciences | Cat# 555729; RRID:AB_396072 |
| BV421 Mouse Anti-Human CD28 Clone CD28.2 | BD Biosciences | Cat# 562613; RRID:AB_2737676 |
| CD28 Monoclonal Antibody (CD28.2), eBioscience | Thermo Fisher Scientific | Cat# 14-0289-82; RRID:AB_467194 |
| PE-CF594 Mouse Anti-Human CD31 Clone WM59 | BD Biosciences | Cat# 563652; RRID:AB_2738349 |
| PE-CF594 Mouse Anti-Human CD45RA Clone HI100 | BD Biosciences | Cat# 562298; RRID:AB_11154413 |
| PE Mouse Anti-Human CD54 Clone HA58 | BD Biosciences | Cat# 555511; RRID:AB_395901 |
| PE-CF594 Mouse Anti-Human CD56 Clone B159 | BD Biosciences | Cat# 562289; RRID:AB_11152080 |
| CD56 FITC Clone NCAM16.2 | BD Biosciences | Cat# 345811; RRID:AB_2868832 |
| BV711 Mouse Anti-Human Invariant NK T Cell | BD Biosciences | Cat# 747720; RRID:AB_2872199 |
| Alexa Fluor® 488 Mouse anti-Human FoxP3 Clone 259D/C7 | BD Biosciences | Cat# 560047; RRID:AB_1645349 |
| PE/Cyanine7 anti-human CD123 Antibody | Biolegend | Cat# 306010; RRID:AB_493576 |
| PE Mouse Anti-Human CD134 Clone L106 | BD Biosciences | Cat# 340420; RRID:AB_400027 |
| BV711 Mouse Anti-Human CD141 Clone 1A4 | BD Biosciences | Cat# 563155; RRID:AB_2738033 |
| PE Mouse Anti-Human CD152 Clone BNI3 | BD Biosciences | Cat# 555853; RRID:AB_396176 |
| PE anti-human CD154 Antibody | Biolegend | Cat# 310806; RRID:AB_314829 |
| BV711 Mouse Anti-Human CD161 Clone DX12 | BD Biosciences | Cat# 563865; RRID:AB_2738457 |
| FITC anti-human/mouse/rat CD278 (ICOS) Antibody | Biolegend | Cat# 313506; RRID:AB_416330 |
| PE Mouse Anti-Human CD25 Clone M-A251 | BD Biosciences | Cat# 555432; RRID:AB_395826 |
| Alexa Fluor® 700 Mouse Anti-Human IFN-γ Clone B27 | BD Biosciences | Cat# 557995; RRID:AB_396977 |
| Vioblue TCRγ/δ Antibody, anti-human | Miltenyi Biotec | Cat# 130-113-507; RRID:AB_2733977 |
| APC-Vio770 TCR Vα7.2 Antibody, anti-human, REAfinity | Miltenyi Biotec | Cat# 130-100-179; RRID:AB_2653673 |
| CD183 (CXCR3)-VioBright FITC, human (clone: REA232) | Miltenyi Biotec | Cat# 130-118-545; RRID:AB_2734058 |
| CD196 (CCR6)-APC, human (clone: REA190) | Miltenyi Biotec | Cat# 130-100-373; RRID:AB_2655933 |
| CD194 (CCR4)-PE, human (clone: REA279) | Miltenyi Biotec | Cat# 130-103-812; RRID:AB_2655905 |
| CD185 (CXCR5)-PE-Vio770, human (clone: REA103) | Miltenyi Biotec | Cat# 130-105-459; RRID:AB_2655788 |
| PE Mouse anti-NF-κB p65 (pS529) | BD Biosciences | Cat# 558423; RRID:AB_647222 |
| CD159a (NKG2A)-APC, human | Miltenyi Biotec | Cat# 130-098-812; RRID:AB_2655386 |
| CD159c (NKG2C)-PE, human (clone: REA205) | Miltenyi Biotec | Cat# 130-103-635; RRID:AB_2655394 |
| CD158a,h PC7 | Beckman Coulter | Cat# A66899 |
| CD158b1,b2,j PC5.5 | Beckman Coulter | Cat# A66900; RRID:AB_2857331 |
| Alexa Fluor 700 anti-human CD158e1 (KIR3DL1, NKB1) Antibody | Biolegend | Cat# 312712; RRID:AB_2130824 |
| Anti-IgM-APC, human | Miltenyi Biotec | Cat# 130-093-076; RRID:AB_1036084 |
| PE-CF594 Mouse Anti-Human IgG Clone G18-145 | BD Biosciences | Cat# 562538; RRID:AB_2737640 |
| FITC IgA Antibody, anti-human | Miltenyi Biotec | Cat# 130-114-001; RRID:AB_2726443 |
| Pacific Blue anti-human HLA-DR | Biolegend | Cat# 980404; RRID:AB_2632616 |
| CD279 (PD-1) Monoclonal Antibody (MIH4), PE, eBioscience | Thermo Fisher Scientific | Cat# 12-9969-42; RRID:AB_10736473 |
| CD366 (TIM3) Monoclonal Antibody (F38-2E2), PE, eBioscience | Thermo Fisher Scientific | Cat# 12-3109-42; RRID:AB_2572605 |
| CD223 (LAG-3) Monoclonal Antibody (3DS223H), PE, eBioscience | Thermo Fisher Scientific | Cat# 12-2239-42; RRID:AB_2572597 |
| TIGIT Monoclonal Antibody (MBSA43), PE, eBioscience | Thermo Fisher Scientific | Cat# 12-9500-42; RRID:AB_10714831 |
| PE anti-human CD272 (BTLA) Antibody | Biolegend | Cat# 344506; RRID:AB_2065761 |
| HPV Monoclonal Antibody (K1H8) | Thermo Fisher Scientific | Cat# MA5-12446; RRID:AB_10978662 |
| PE Mouse Anti-Human CD15 Clone HI98 | BD Biosciences | Cat# 555402; RRID:AB_395802 |
| PE-Cy7 Mouse Anti-Human CD16 Clone 3G8 | BD Biosciences | Cat# 560918; RRID:AB_10563252 |
| Polyclonal Goat Anti-Mouse Ig Clone Polyclonal | BD Biosciences | Cat# 553998; RRID:AB_395195 |
| PE Mouse IgG2b κ Isotype Control Clone 27–35 | BD Biosciences | Cat# 555743; RRID:AB_396086 |
| Anti-TNF-α-APC, human | Miltenyi Biotec | Cat# 130-091-649; RRID:AB_244201 |
| PE/Cy7 anti-human IL-2 | Sony | Cat# 3101630 |
| V5 Tag Monoclonal Antibody, HRP | Thermo Fisher Scientific | Cat# R961-25; RRID:AB_2556565 |
| GAPDH Antibody (0411) HRP | Santa Cruz Biotechnology | Cat# sc-47724 HRP; RRID:AB_627678 |
| Antibody against mouse papillomavirus E4 | in house | Rabbit serum |
| Antibody against mouse papillomavirus L1 | in house | MPV.B9 |
| Rabbit polyclonal HPVE2 serum | John Doorbar Lab. | N/A |
| Mouse MCM7 antibody | Thermo Fisher Scientific | Cat# MA5-14291; RRID:AB_11009501 |
| Goat anti-rabbit IgG (H+L)Alexa 594 | Thermo Fisher Scientific | Cat# A11012; RRID:AB_141359 |
| Immpress anti-mouse IgG HRP | Vector Labs | Cat# 30026; RRID:AB_2336532 |
| monoclonal mouse IgG1 anti-tag (supernatant from KT3 hybridoma cell line) | (MacArthur and Walter, 1984) | N/A |
| Biotin-SP-conjugated AffiniPure Goat Anti-Mouse IgG + IgM (H+L) | Jackson ImmunoResearch Labs | Cat# 115-065-068; RRID:AB_2338563 |
| Biotin-SP-conjugated AffiniPure Goat Anti-Human IgA + IgG + IgM (H+L) | Jackson ImmunoResearch Labs | Cat# 109-065-064; RRID:AB_2337627 |
| Bacterial and virus strains | ||
| expanded T7 Virscan phage library | S. Elledge (Brigham and Women’s Hospital and Harvard University Medical School, Boston, MA, USA) | VirScan Phage Library, version 3 |
| One Shot TOP10 Chemically Competent E. coli | Thermo Fisher Scientific | Cat# C404003 |
| NEB Stable Competent E. coli (High Efficiency) | New England Biolabs | Cat# C3040H |
| Mouse papillomavirus | HSD:NU mouse tail lesions | MmuPV1 |
| E.coli BL21 | Sehr et al., 2001 | N/A |
| E.coli Rosetta | Michael et al., 2008 | N/A |
| Biological samples | ||
| Peripheral blood mononuclear cells from indicated individuals | This manuscript | N/A |
| Plasma from indicated individuals | This manuscript | N/A |
| Skin scraps of warts | This manuscript | N/A |
| Skin biopsies of patient and control warts | This manuscript | N/A |
| Chemicals, peptides, and recombinant proteins | ||
| Polyethylenimine | Polysciences | Cat# 23966 |
| Opti-MEM | Thermo Fisher scientific | Cat# 31985070 |
| Dulbecco’s Modified Eagle Medium | Nacalai | Cat# 08459-64 |
| DMEM, high glucose, GlutaMAX(TM) | Thermo Fisher scientific | Cat# 61-965-026 |
| RPMI 1640 Medium, GlutaMAX Supplement | Thermo Fisher scientific | Cat# 61870010 |
| X-VIVO 20 Serum-free Hematopoietic Cell Medium | Lonza | Cat# BE04-448Q |
| Protease inhibitor cocktail | Sigma-Aldrich | Cat# P8340 |
| FLAG peptide | Sigma-Aldrich | Cat# F3290 |
| Lys48-linked polyubiquitin chains | Boston Biochem | Cat# UC-230-100 |
| 1 M Tris-HCl | Invitrogen | Cat# 15567-027 |
| 0.1 M DTT (dithiothreitol) | Affymetrix | Cat# 70726 150 UL |
| HL-dsDNase | ArcticZymes | Cat# 70800-201 |
| 20 mM Nuclease-free MgCl2 | Thermo Scientific | Cat# AB-0359 |
| EvaGreen for qPCR | Biotium | Cat# 31000 |
| intravenous immunoglobulin (IVIg) | CSL Behring | Privigen |
| IgG-depleted human serum | Molecular Innovations, Inc. | Cat# HPLASERGFA5ML |
| Protein Transport Inhibitor (Containing Brefeldin A) | BD Biosciences | Cat# 555029 |
| Protein Transport Inhibitor (Containing Monensin) | BD Biosciences | Cat# 554724 |
| Tuberculin/PPD | STATEN SERUM INSTITUT | N/A |
| Sephadex G-50 Superfine, Cytiva | Merck | Cat# GE17-0041-01 |
| Phytohemagglutinin PHA-M, lyophilized powder | Sigma | Cat# L2646-10MG |
| Phorbol 12-myristate 13-acetate | Sigma aldrich | Cat# P8139-1MG |
| Ionomycin calcium salt from Streptomyces conglobatus | Sigma aldrich | Cat# I0634-5MG |
| Human IL-2 Recombinant Protein | Thermo Fisher Scientific | Cat# RP-8605 |
| Ficoll® Paque Plus, Cytiva | Merck | Cat# GE17-1440-03 |
| Fetal Bovine serum | Thermo Fisher Scientific | Cat# 16000036 |
| Protamine sulfate | Merck | Cat# P3369-10G |
| Human Serum from human male AB plasma, USA origin, sterile-filtered | Merck | Cat# H4522 |
| PepMix HCMVA (pp65) (> 70%) | JPT technologies | Cat# PM-PP65-1 |
| Proleukin | Novartis | N/A |
| HPV-2E6 overlapping peptides | JPT technologies | Custom order |
| HPV-4L1 overlapping peptides | JPT technologies | Custom order |
| Mouse papillomavirus E4 peptide | https://Chinapeptides.net | PKTTPPRRELFPPTPLTQPP |
| Mouse papillomavirus L1 virus like particles (produced in HEK293T) | In house | MmuPV1-L1-VLPs |
| Tyramide CF 488 | Biotium | Cat# 92171 |
| Dapi: 4’,6-Diamidino-2-phenylindol dihydrochloride | Thermo Fisher Scientific | Cat# 11926621 |
| PE-Streptavidin Conjugate | Moss,Inc. | Cat# SAPE-001 |
| HPV 2, 4, 6, 11, 16, 18 L1 antigens for multiplex serology | (Michael et al., 2008) | N/A |
| SeroMap Microspheres | Luminex (Austin, TX, USA) | Cat# L100-Sxxx-04 |
| Critical commercial assays | ||
| LIVE/DEAD Viability kit | Thermo Fisher Scientific | Cat# L3224 |
| Chromium Single Cell 3′ Reagent Kits (v3.1) | 10X Genomics | Cat# 120237 |
| Chromium Single Cell 5′ Library & Gel Bead kit (V1) | 10X Genomics | Cat# 1000014 |
| Chromium Single Cell 5′ Feature Barcode Library Kit | 10X Genomics | Cat# 1000080 |
| Memory CD4+ T Cell Isolation Kit, human | Miltenyi | Cat# 130-091-893 |
| Dead Cell Removal Kit | Miltenyi | Cat# 130-090-101 |
| Taqman Universal PCR Master Mix for qPCR | Thermo Fisher Scientific | Cat# 4304437 |
| Taqman Gene Expression Assays – CD28-FAM (Probe 1: Hs00174796_m1 and probe 2: Hs01007422_m1) and GUSB | Thermo Fisher Scientific | Cat# 4331182, Cat# 4326320E |
| QIAprep Spin Miniprep Kit | QIAGEN | Cat# 27106 |
| RNeasy Fibrous Tissue Mini Kit | QIAGEN | Cat# 74704 |
| RNeasy Plus Mini Kit | QIAGEN | Cat# 74136 |
| RNeasy Plus Micro Kit | QIAGEN | Cat# 74034 |
| HiSpeed Plasmid Maxi Kit | QIAGEN | Cat# 12663 |
| SuperSignal West Femto Maximum Sensitivity Substrate | Thermo Fisher Scientific | Cat# 34096 |
| LIVE/DEAD Fixable Aqua Dead Cell Stain Kit | Thermo Fisher Scientific | Cat# L34966 |
| Foxp3 / Transcription Factor Staining Buffer Set | Thermo Fisher Scientific | Cat# 00-5523-00 |
| T Cell Activation/Expansion Kit, human | Miltenyi Biotec | Cat# 130-091-441 |
| MasterMix Multiplex Kit | QIAGEN | Cat# 206145 |
| Specific Primer mix (βHPV, γHPV, or warts specific HPV) | International Agency for research on Cancer | N/A |
| Color-coded beads, coupled with specific probe for each HPV | International Agency for research on Cancer | N/A |
| Streptavidin, R-Phycoerythrin Conjugate | Molecular ProbesTM | Cat# S866 |
| Silver Stain Kit | Wako | Cat# 299-58901 |
| Agilent High Sensitivity DNA Kit | Agilent Technologies | Cat# 5067-4626 |
| RNA ScreenTape Analysis | Agilent Technologies | Cat# 5067-5576 |
| RNA ScreenTape Sample buffer | Agilent Technologies | Cat# 5067-5577 |
| QuikChange II XL Site-Directed Mutagenesis Kit | Agilent Technologies | Cat# 200521 |
| SureSelect Human All Exon V6 | Agilent Technologies | Cat# 5190-8863 |
| Ovation Universal RNA-Seq System 1–16 | TECAN (NuGen) | Cat# 0343 |
| CloneAmp HiFi PCR Premix | Takara Bio | Cat# 639298 |
| SMART-Seq® v4 Ultra® Low Input RNA Kit for Sequencing | Takara Bio | Cat# 634891 |
| In-Fusion® Snap Assembly Master Mix | Takara Bio | Cat# 638948 |
| Nextera XT DNA Library Preparation Kit | Ilumina | Cat# FC-131-1096 |
| Nextera XT Index Kit v2 set A | Ilumina | Cat# TG-131-2001 |
| Protein A Dynabeads | Thermo Fisher Scientific | Cat# 10002D |
| Protein G Dynabeads | Thermo Fisher Scientific | Cat# 10004D |
| QIAquick PCR purification kit (50) | QIAGEN | Cat# 28104 |
| Human IgG TOTAL ELISA | Thermo Fisher Scientific | Cat# 501128669 |
| QIAquick Gel Extraction Kit | QIAGEN | Cat# 28704 |
| Hiseq4000 (300 cycles), paired end kit | Illumina | Cat# FC-410-1003 |
| Nextseq 500 High-output Kit v2 (75 cycles) | Illumina | Cat# FC-4044-2005 |
| Perm Buffer III | BD Biosciences | Cat# 558050 |
| Fix Buffer I | BD Biosciences | Cat# 557870 |
| Bond Polymer Refine Detection | Leica | Cat# DS9800 |
| Invitrogen iPrep PureLink gDNA Blood Kit | Thermo Fisher Scientific | Cat# 10552894 |
| Genome-Wide Human SNP Array 6.0 | Thermo Fisher Scientific | Cat# 901153 |
| BigDye Terminator v3.1 Cycle Sequencing Kit | Thermo Fisher Scientific | Cat# 4337457 |
| Oligo(dT)12-18 Primer | Thermo Fisher Scientific | Cat# 18418012 |
| Reverse Transcriptase SuperScript II | Thermo Fisher Scientific | Cat# 18044-014 |
| Taq DNA polymerase | Thermo Fisher Scientific | Cat# 10342053 |
| TOPO TA Cloning Kit for Sequencing | Thermo Fisher Scientific | Cat# 450030 |
| pcDNA3.1/V5-His TOPO TA Expression Kit | Thermo Fisher Scientific | Cat# K480001 |
| X-tremeGENE 9 DNA Transfection Reagent | Merck | Cat# 6365779001 |
| Calcium Phosphate Transfection Kit | Thermo Fisher Scientific | Cat# K278001 |
| Acrodisc Syringe Filters with Supor Membrane, Sterile - 0.2 μm | Pall | Cat# 4612 |
| CellTrace CFSE Cell Proliferation Kit, for flow cytometry | Thermo Fisher Scientific | Cat# C34570 |
| M.O.M. (Mouse on Mouse) ImmPRESS HRP (Peroxidase) Polymer Kit | Vector | Cat# MP-2400 |
| ImmPRESS anti-rabbit IgG polymer system | Vector | Cat# MP-7801 |
| ImmPACT NovaRED Substrate | Vector | Cat# SK-4805 |
| 50% hematoxylin Gill’s No. 1 solution | Sigma-Aldrich | Cat# GHS132-1L |
| Nuclear Fast Red | American MasterTech, Inc. | Cat# SSKC398 |
| RNAscope® 2.5 VS Probe- V-MusPV-E4 | Advanced Cell Diagnostics, Inc. | Cat# 473289 |
| RNAscope 2.5 HD Assay – BROWN | Advanced Cell Diagnostics, Inc. | Cat# 322300 |
| Megaprime DNA Labeling System | Amersham | Cat# RPN1604 |
| The Brilliant III qPCR kit | Agilent | Cat# 600880 |
| The RevertAid First Strand cDNA synthesis kit | Thermo-Fisher | Cat# K1622 |
| RNAScope 2.5 HD Assay Brown | ACD/Bio-Techne | Cat# 322310 |
| HPV 2 E6/E7 C1 RNAScope probe | ACD/Bio-Techne | Cat# 80660 |
| Human PPIB RNAScope probe | ACD/Bio-Techne | Cat# 313901 |
| Deposited Data | ||
| 3′ Single-cell RNA-seq of the patient PBMC or healthy controls | This manuscript | EGA: EGAS00001004837 |
| CITE-seq (5′) single-cell RNA-seq of P1 and P2 PBMC and 1 healthy control | This manuscript | EGA: EGAS00001004837 |
| High-throughput sequencing (HTS) of T cell receptor β (TRB) and T cell receptor α (TRA) dataset (control and patients) | Adaptive Biotechnologies |
http://clients.adaptivebiotech.com/login |
| Email: beziat-review@adaptivebiotech.com | ||
| Password: beziat2021review | ||
| Whole-Exome and genome Sequencing of the patients (whole blood DNA and warts) | This manuscript | Sequence Read Archive (SRA: PRJNA715377) |
| Primary CD4+ naive T cell RNA-Seq data from the patient and heathy controls | This manuscript | gene expression omnibus (GEO: GSE139299) |
| RNA-Seq of the lesions of P1 and control common warts | This manuscript | gene expression omnibus (GEO: GSE139259) |
| Full HPV2 genome from P1 | This manuscript | GenBank: MN605988 |
| Full HPV4 genome from P2 and P3 | This manuscript | GenBank: MN605989 |
| Experimental models: cell lines | ||
| HEK293T cells | ATCC | Cat# CRL-11268, RRID:CVCL_1926 |
| Expanded CD4+ T cells from healthy controls or Patients’ family | This manuscript | N/A |
| P815 | ATCC | Cat# ATCC TIB-64 |
| Jurkat | In House | N/A |
| Experimental models: mouse strains | ||
| C57BL/6 mice | https://www.jax.org | https://www.jax.org/strain/000664 |
| CD28ko mice | https://www.jax.org | 002666 - B6.129S2-Cd28tm1Mak/J |
| Rag1ko mice | https://www.jax.org | https://www.jax.org/strain/002216 |
| Oligonucleotides | ||
| IS7_HsORF5_2 | IDT Integrated DNA technologies | ACACTCTTTCCCTACACGACTCCAGTC AGGTGTGATGCTC |
| IS8_HsORF3_2 | IDT Integrated DNA technologies | GTGACTGGAGTTCAGACGTGTGCTC TTCCGATCCGAGCTTATCGTCGTCATCC |
| IS4_HsORF5_2 | IDT Integrated DNA technologies | AATGATACGGCGACCACCGAGATCTA CACTCTTTCCCTACACGACTCCAGT |
| T7-Pep2.2_SP_subA | IDT Integrated DNA technologies | CTCGGGGATCCAGGAATTCCGCTGCGT |
| T7-Pep2.2_SP_subB | IDT Integrated DNA technologies | CTCGGGGATCCAGGAATTCGGAGCGGT |
| CD28-gDNA-FOR (sequencing gDNA) | Thermo Fisher Scientific | GCGTCTTTCAGTTCCCCTCA |
| CD28-gDNA-REV (sequencing gDNA) | Thermo Fisher Scientific | ACACATTGCCCTATTACAGCAAAA |
| CD28-cDNA-5UTR-FOR (sequencing cDNA + Exon trapping) | Thermo Fisher Scientific | TGGAACCCTAGCCCATCGTCA |
| CD28-cDNA-3UTR-REV (sequencing cDNA) | Thermo Fisher Scientific | AGCCGGCTGGCTTCTGGATA |
| ACTB-cDNA-FOR | Thermo Fisher Scientific | CCTTCCTGGGCATGGAGTCCT |
| ACTB-cDNA-REV | Thermo Fisher Scientific | AATCTCATCTTGTTTTCTGCG |
| pCMV6-FOR (sequencing insertion in pCMV6) | Thermo Fisher Scientific | ATTCGTCGACTGGATCCGGTA |
| pCMV6-REV (sequencing insertion in pCMV6 + Exon trapping) | Thermo Fisher Scientific | CATTTGCTGCCAGATCCTCTT |
| pLVX-mCherry-CD28-FOR (Cloning in pLVX) | Thermo Fisher Scientific | TATTTCCGGTGAATTATGC TCAGGCTGCTCTTGGC |
| pLVX-mCherry-CD28-REV (Cloning in pLVX) | Thermo Fisher Scientific | GAGAGGGGCGGGATCTCA GGAGCGATAGGCTGCG |
| ExonTrap-CD28-UTR-FOR (Cloning in pCMV6) | Thermo Fisher Scientific | CGAGGAGATCTGCCGCCGCG GCGTCTTTCAGTTCCCCTCAC |
| ExonTrap-CD28-Int1-REV (Cloning in pCMV6) | Thermo Fisher Scientific | TTATCTCTCTCTGCCACC TGTACATCCTTGG |
| ExonTrap-CD28-Int1-FOR (Cloning in pCMV6) | Thermo Fisher Scientific | CAGGTGGCAGAGAGAGAT AACTCCCCTCTGGAGTC |
| ExonTrap-CD28-ex2 -REV (Cloning in pCMV6) | Thermo Fisher Scientific | CTCGAGCGGCCGCGTACGCGTTTC ACATGGATAATGGTTCCATTG |
| CD28-cDNA-ATG-directional-FOR (Cloning in pcDNA3.1) | Thermo Fisher Scientific | CACCATGCTCAGGCTGCT CTTGGCTCTCA |
| CD28-cDNA-3′w/o.stop-REV (Cloning in pcDNA3.1) | Thermo Fisher Scientific | GGAGCGATAGGCTGCGAAGT |
| MUTsplice-CD28-ExonTrap-FOR (Mutagenesis c.52G>A Exon Trapping) | Thermo Fisher Scientific | CAATTCAAGTAACAAGTAAACAATG |
| MUTsplice-CD28-ExonTrap-REV (Mutagenesis c.52G>A Exon Trapping) | Thermo Fisher Scientific | CATTGTTTACTTGTTACTTGAATTG |
| MUTsplice-CD28-ExonTrap-FOR (Mutagenesis c.52G>A +5A>G Exon Trapping) | Thermo Fisher Scientific | GTAACAAGTAAGCAATGTTAATG |
| MUTsplice-CD28-ExonTrap-REV (Mutagenesis c.52G>A +5A>G Exon Trapping) | Thermo Fisher Scientific | CATTAACATTGCTTACTTGTTAC |
| MUT CD28 Gly18Arg For (Mutagenesis Gly18Arg) | Thermo Fisher Scientific | ATTCAAGTAACAAGAAACAAGAT |
| MUT CD28 Gly18Arg Rev (Mutagenesis Gly18Arg) | Thermo Fisher Scientific | ATCTTGTTTCTTGTTACTTGAAT |
| HPV-2 F1 (Primer for whole-HPV genome sequencing) | Thermo Fisher Scientific | 5′-AACCGCTCAGGATGACGAAG-3′ |
| HPV-2 R1 (Primer for whole-HPV genome sequencing) | Thermo Fisher Scientific | 5′-TCTAAGCGGGACCACGACCT-3′ |
| HPV-2 F2 (Primer for whole-HPV genome sequencing) | Thermo Fisher Scientific | 5′-CCCTAATGATAACAACCAACAC-3′ |
| HPV-2 R2 (Primer for whole-HPV genome sequencing) | Thermo Fisher Scientific | 5′-TACGCTGTTCAACGCTGGT-3′ |
| HPV-2 F2 (Primer for whole-HPV genome sequencing) | Thermo Fisher Scientific | 5′-GCAGCCTCAGCAGAATCAA-3′ |
| HPV-2 R3 (Primer for whole-HPV genome sequencing) | Thermo Fisher Scientific | 5′-TCAACTACAGTGGTGGGTCGC-3′ |
| HPV-2 F4 (Primer for whole-HPV genome sequencing) | Thermo Fisher Scientific | 5′-GTGGAACAGAACACTTTAGCAG-3′ |
| HPV-2 R4 (Primer for whole-HPV genome sequencing) | Thermo Fisher Scientific | 5′-GCGGGTAACTCATCAAGCAAT-3′ |
| HPV-2 F5 (Primer for whole-HPV genome sequencing) | Thermo Fisher Scientific | 5′-GTTTTAGTAGGTTGGGACGC-3′ |
| HPV-2 R5 (Primer for whole-HPV genome sequencing) | Thermo Fisher Scientific | 5′-TACGCAGCGAGAAGAACATAG-3′ |
| HPV-2 F6 (Primer for whole-HPV genome sequencing) | Thermo Fisher Scientific | 5′-TAACACAACTATTGAGGACGGG-3′ |
| HPV-2 R6 (Primer for whole-HPV genome sequencing) | Thermo Fisher Scientific | 5′-TTCATACGGGAGGGGATAC-3′ |
| HPV-2 F7 (Primer for whole-HPV genome sequencing) | Thermo Fisher Scientific | 5′-GTATCCCCTCCCGTATGAAT-3′ |
| HPV-2 R7 (Primer for whole-HPV genome sequencing) | Thermo Fisher Scientific | 5′-TTCGTCATCCTGAGCGGTTT-3′ |
| HPV-2 F8 (Primer for whole-HPV genome sequencing) | Thermo Fisher Scientific | 5′-GCTGGGGCAATAGGGTCTTT-3′ |
| HPV-2 R8 (Primer for whole-HPV genome sequencing) | Thermo Fisher Scientific | 5′-AGTTGGCTGCAAAAACGACG-3′ |
| HPV-2 F9 (Primer for whole-HPV genome sequencing) | Thermo Fisher Scientific | 5′-TAAGTGTGGCAGAACCGTCC-3′ |
| HPV-2 R9 (Primer for whole-HPV genome sequencing) | Thermo Fisher Scientific | 5′-TTACTCAGCAACGTCGCCTT-3′ |
| HPV-4 F1 (Primer for whole-HPV genome sequencing) | Thermo Fisher Scientific | 5′-AAAAGGGACAGTGCATTTCTACT-3′ |
| HPV-4 R1 (Primer for whole-HPV genome sequencing) | Thermo Fisher Scientific | 5′-GTGCAGCAAAACGTCAGCTT-3′ |
| HPV-4 F2 (Primer for whole-HPV genome sequencing) | Thermo Fisher Scientific | 5′-GAGGAGTCGGTGGTTCCATT-3′ |
| HPV-4 R2 (Primer for whole-HPV genome sequencing) | Thermo Fisher Scientific | 5′-TGTATGAGACCCCATACCATTC-3′ |
| HPV-4 F2 (Primer for whole-HPV genome sequencing) | Thermo Fisher Scientific | 5′-GGCTGGACCTTCTAGCCAAG-3′ |
| HPV-4 R3 (Primer for whole-HPV genome sequencing) | Thermo Fisher Scientific | 5′-TGGCTTCCAATCTCCTTCTTCA-3′ |
| HPV-4 F4 (Primer for whole-HPV genome sequencing) | Thermo Fisher Scientific | 5′-GTACGCAGAGGAGGATGCAA-3′ |
| HPV-4 R4 (Primer for whole-HPV genome sequencing) | Thermo Fisher Scientific | 5′-AAACGTGCGACTAGGGACTC-3′ |
| HPV-4 F5 (Primer for whole-HPV genome sequencing) | Thermo Fisher Scientific | 5′-TACTGACGGTACTTGGAAATCTT-3′ |
| HPV-4 R5 (Primer for whole-HPV genome sequencing) | Thermo Fisher Scientific | 5′-CCTCAGTGTCGAAGGAGGAG-3′ |
| HPV-4 F6 (Primer for whole-HPV genome sequencing) | Thermo Fisher Scientific | 5′-CAGACCATACGGGAGAAAGAGC-3′ |
| HPV-4 R6 (Primer for whole-HPV genome sequencing) | Thermo Fisher Scientific | 5′-TTCCTTCTACTCAAGCTTTGCAT-3′ |
| HPV-4 F7 (Primer for whole-HPV genome sequencing) | Thermo Fisher Scientific | 5′-GCACTGACCAAAGAGACGCT-3′ |
| HPV-4 R7 (Primer for whole-HPV genome sequencing) | Thermo Fisher Scientific | 5′-CTCCCCTAGTTGCCAATGCT-3′ |
| HPV-4 F8 (Primer for whole-HPV genome sequencing) | Thermo Fisher Scientific | 5′-GCTAGCAGCCACCCTACAAT-3′ |
| HPV-4 R8 (Primer for whole-HPV genome sequencing) | Thermo Fisher Scientific | 5′-TGCTTTGTTCTCCTGAATGTTGAC-3′ |
| HPV-4 F9 (Primer for whole-HPV genome sequencing) | Thermo Fisher Scientific | 5′-AAGTGGTGTGCAAATTGGGC-3′ |
| HPV-4 R9 (Primer for whole-HPV genome sequencing) | Thermo Fisher Scientific | 5′-CAAATCTGTTTGGGTCTGGCA-3′ |
| HPV-4 F10 (Primer for whole-HPV genome sequencing) | Thermo Fisher Scientific | 5′-TTCCACGCTGGTACAGAAAGG-3′ |
| HPV-4 R10 (Primer for whole-HPV genome sequencing) | Thermo Fisher Scientific | 5′-TAGAGCATCTCCCATGGTGC-3′ |
| HPV-4 F11 (Primer for whole-HPV genome sequencing) | Thermo Fisher Scientific | 5′-TGCTCCTTTGGATGTCATTGC-3′ |
| HPV-4 R11 (Primer for whole-HPV genome sequencing) | Thermo Fisher Scientific | 5′-AAACCGCCTGCCTAAGGAAA-3′ |
| HPV-4 F12 (Primer for whole-HPV genome sequencing) | Thermo Fisher Scientific | 5′-CCTACACAGACCCCTGCAAC-3′ |
| HPV-4 R12 (Primer for whole-HPV genome sequencing) | Thermo Fisher Scientific | 5′-TGCAGAAGTCGTCCAAGGTT-3′ |
| USP37-MUT-FOR (Mutagenesis Glu459Lys) | Thermo Fisher Scientific | GAACCTGTTTCTGGAAAAGAAAATTCAC |
| USP37-MUT-REV (Mutagenesis Glu459Lys) | Thermo Fisher Scientific | GTGAATTTTCTTTTCCAGAAACAGGTTC |
| KANSL1L-MUT-FOR (Mutagenesis Ser577Thr) | Thermo Fisher Scientific | GTACAGATTGACCCCTA CTTTTTATTGGAC |
| KANSL1L-MUT-REV (Mutagenesis Ser577Thr) | Thermo Fisher Scientific | GTCCAATAAAAAGTAGG GGTCAATCTGTAC |
| Primers for mouse papillomavirus | IDT | 5′-TAGCTTTGTCTGCCCGCACT-3′ |
| Primers for mouse papillomavirus | IDT | 5′-GTCAGTGGTGTCGGTGGGAA-3′ |
| Probe for mouse papillomavirus | IDT | 5′FAM-CGGCCCGAAGACAACAC CGCCACG-3′TAMRA |
| Recombinant DNA | ||
| pCMV6-Empty vector | Origene | Cat# PS100001 |
| pcDNA3.1/V5-His-Empty vector | Thermo Fisher Scientific | Cat# V81020 |
| pCMV6-CD28_WT-Myc-DDK | Origene | Cat# RC211318 |
| pCMV6-CD28_Gly18Arg-V5-His | This manuscript | N/A |
| pCMV6-CD28_Val16fs-V5-His | This manuscript | N/A |
| pCMV6-CD28_I1-Ret-V5-His | This manuscript | N/A |
| pcDNA3.1-CD28_WT-V5-His | This manuscript | N/A |
| pcDNA3.1-CD28_Gly18Arg-V5-His | This manuscript | N/A |
| pcDNA3.1-CD28_Val16fs-V5-His | This manuscript | N/A |
| pcDNA3.1-CD28_I1-Ret-V5-His | This manuscript | N/A |
| pCMV6-KANSL1L_WT-Myc-DDK | Origene | Cat# RC215502 |
| pCMV6-KANSL1L_Ser577Thr-Myc-DDK | This manuscript | N/A |
| pCMV6-USP37_WT-Myc-DDK | Origene | Cat# RC223407 |
| pCMV6-USP37_Glu459Lys -Myc-DDK | This manuscript | N/A |
| pLVX-EF1α-IRES-mCherry | Clontech | Cat# 631987 |
| pLVX-EF1α- CD28_WT-IRES-mCherry | This manuscript | N/A |
| pLVX-EF1α-CD28_Gly18Arg-IRES-mCherry | This manuscript | N/A |
| psPAX2 | Addgene | Cat# 12260 |
| pCMV-VSV-G | Addgene | Cat# 8454 |
| pHXB2-Env | NIH-AIDS Reagent Program | Cat# 1069 |
| pCMV6-CD28_WT-ExonTrapping | This manuscript | N/A |
| pCMV6-CD28_c.52G>A-ExonTrapping | This manuscript | N/A |
| pCMV6-CD28_c.52+5A>G-ExonTrapping | This manuscript | N/A |
| Software and algorithms | ||
| Cell Ranger | 10X Genomics | v5.0.1 |
| DoubletFinder | McGinnis et al., 2019 | v2.0.3 |
| Seurat R package | Stuart et al., 2019 | V4.0.0 |
| Uniform Manifold Approximation and Projection (UMAP) | Becht et al., 2018 | v.0.3.5 |
| MAST | Finak et al., 2015 | v1.16.0 |
| BWA | Li and Durbin, 2010 | https://github.com/lh3/bwa |
| RSeQC | Wang et al., 2012 | http://rseqc.sourceforge.net |
| DESeq2 | Love et al., 2014) | https://bioconductor.org/packages/release/bioc/html/DESeq2.html |
| HPVDetector | Chandrani et al., 2015 | N/A |
| HTSeq | Anders et al., 2015 | https://github.com/htseq/htseq |
| IGV | Robinson et al., 2011 | https://software.broadinstitute.org/software/igv/ |
| R | The R Project for Statistical Computing | https://www.r-project.org |
| STAR aligner | Dobin et al., 2013 | https://github.com/alexdobin/STAR |
| VarScan | Koboldt et al., 2012 | http://dkoboldt.github.io/varscan/ |
| Fiji Software | Schindelin et al., 2012 | https://fiji.sc/ |
| ImmunoSEQ ANALYZER | Adaptive Biotechnologies | http://clients.adaptivebiotech.com/login |
| ComplexHeatmap | Gu et al., 2016 | http://www.bioconductor.org/packages/devel/bioc/html/ComplexHeatmap.html |
| phip-stat | Mohan et al., 2019 | https://github.com/lasersonlab/phip-stat |
| Bowtie for alignment of PhIP-Seq raw reads | Mohan et al., 2019 | http://bowtie-bio.sourceforge.net/index.shtml |
| MERLIN 1.1.2 software | Abecasis et al., 2002 | http://csg.sph.umich.edu/abecasis/merlin/download/ |
| GATK HaplotypeCaller | McKenna et al., 2010 | https://www.broadinstitute.org/gatk |
| SAMtools | Li et al., 2009 | http://samtools.sourceforge.net/ |
| Picard | http://broadinstitute.github.io/picard/ | http://broadinstitute.github.io/picard/ |
| Alamut Visual 2.15 | https://www.interactive-biosoftware.com/alamut-visual/ | N/A |
| BioRender | https://biorender.com/ | N/A |