Skip to main content
. 2020 Dec 8;2(1):94–150. doi: 10.1039/d0cb00136h

Thermal denaturation studies (Tm values) of PS-ODN with complementary RNA and their half-life evaluations against SVPDE, Pol I and fetal calf serum (FCS)79.

ODN (5′ → 3′)a T m with RNA (°C) t 1/2 b RNase-H activation
SVPDE (s) Pol I (min) FCS (h)
[d(CTCTCGCACCCATCTCTCTCCTTCT)]-all-PO 73.1 88 30
Hairpin-all-POc 72 >1000 >120
[d(CTCTCGCACCCATCTCTCTCCTTCT)]-all-PS 65 120 ≫16
Hairpin-all-PSc 63 >240 ∼4
a

PS and PO refer to the phosphorothioate and phosphodiester internucleoside linkages respectively.

b

ODN not tested.

c

Hairpin loop structure of the ODN studied.