Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primer sequences used for RT_PCR analysis of a defense-related gene.
| Primer | Sequence (5′->3′) | Length | Tm | GC% | Self complementarity | Self 3′ complementarity |
|---|---|---|---|---|---|---|
| EF1α Forward | TCTGTTGTTGTAACAAGATGGATGC | 25 | 60.05 | 40.00 | 8.00 | 2.00 |
| EF1α Reverse | AAGGTTGGTGGACCTCTCAATC | 22 | 59.96 | 50.00 | 5.00 | 5.00 |
| NPR3 Forward | GTACCTTGAGAACAGAGTGGCA | 22 | 59.96 | 50.00 | 4.00 | 3.00 |
| NPR3 Reverse | GAAAGACCAGCAAACTCGGATG | 22 | 59.84 | 50.00 | 3.00 | 1.00 |
