Table-1. Sequences of Real-Time PCR Primers and Amplification Reactions Conditions for Evaluation of the Relative Expression of Melanocortin-4 receptor (MC4R), Kiss1, and β-actin mRNA in the Rat Arcuate Nucleus of the Hypothalamus .

Primer	Sense and Anti-sense Sequence	Amplicon Length (bp)	Amplification Condition
MC4R	GACGGAGGATGCTATGAG AGGTTCTTGTTCTTGGCTAT	116	15 min at 94℃, 40 cycles of 94℃ 10 s, 56.6℃ 15 s, and 72℃ 30 s
Kiss1	GCTGCTTCTCCTCTGTGT TAACGAGTTCCTGGGGTC	107	15 min at 94℃, 40 cycles of 94℃ 10 s, 58℃ 15 s, and 72℃ 30 s
β - actin	CCACACTTTCTACAATGAGC ATACAGGGACAACACAGC	169	15 min at 94℃, 40 cycles of 94℃ 15 s, 57.8℃ 20 s, and 72℃ 30 s