Table 4.
Validated and predicted targets of the miRNAs dysregulated in RCC patients. These target proteins were identified using miRWalk 2.0 and were further integrated within the renal cell carcinoma pathway from KEGG. Validated targets are those that have been empirically validated to be regulated by a miRNA. Predicted targets are those that have been theoretically estimated based the free binding energy between a miRNA and a putative target mRNA sequence.
| Renal cell carcinoma Pathway | |||
|---|---|---|---|
| miRNA | Sequence | Validated Targets | Predicted Targets |
| Comparison: RCC Patients before Surgery and Controls | |||
| miR-200a-3p * | uaacacugucugguaacgaugu | GRB2 | HGF, TGFB2, CUL2 |
| miR-34a-5p * | uggcagugucuuagcugguugu | FH, GRB2, MAP2K1, MAPK3, MET, VEGFA | PIK3CB, PTPN11, ARNT |
| miR-365a-3p * | uaaugccccuaaaaauccuuau | AKT1, KRAS, RAC1 | TGFB3, PIK3R3 |
| miR-205-5p | uccuucauuccaccggagucug | - | VEGFA, MAPK3, PIK3CG, TCEB1, EGLN2, VEGFA |
| let-7d-5p | agagguaguagguugcauaguu | - | BRAF, HGF |
| Comparison: RCC Patients before (t0) and After Surgery (t1) | |||
| let-7d-5p | agagguaguagguugcauaguu | - | BRAF, HGF |
| miR-152-3p | ucagugcaugacagaacuugg | KRAS, SOS2, TGFA | ETS1, SOS1, TGFB2, EPAS1, SLC2A1, MET, JUN, PAK3, GRB2, GAB1 |
| miR-30c-5p | uguaaacauccuacacucucagc | CUL2, EP300, ETS1, GAB1, MAP2K1, PIK3R2, RAC1, RAP1B, TGFA | PIK3CB, PIK3CD, EGLN1, TCEB1 |
| miR-362-3p | aacacaccuauucaaggauuca | ARNT, CRK, ETS1, PAK6, PIK3CG, PIK3R1, RAPGEF1, VEGFA | AKT2, MET, CUL2, RAP1B, CDC42, RBX1 |
| miR-30e-3p | cuuucagucggauguuuacagc | CRK, KRAS, SOS2 | GRB2, EGLN1, RBX1, MAP2K2 |
* miRNAs included in the multivariable elastic net logistic regression model of ccRCC before surgery (t0) compared to healthy controls. miRNA sequences detailed in accordance with miRBase 22.1.