KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| anti-CD45.1 (clone A20) | Biolegend | Cat# 110724 |
| anti-CD45.2 (clone 104) | Biolegend | Cat# 109824 |
| anti-CD3 (clone 17A2) | Biolegend | Cat# 100214 |
| anti-CD4 (clone GK1.5) | Biolegend | Cat# 100422 |
| anti-CD25 (clone PC61) | Biolegend | Cat# 102026 |
| anti-KLRG1 (clone 2F1/KLRG1) | Biolegend | Cat# 138416 |
| anti-IFNAR1 (clone MAR1–5A3) | Biolegend | Cat# 127312 |
| anti-TCR Vα2 (clone B20.1) | Biolegend | Cat# 127806 |
| anti-CD45 (clone 30-F11) | Biolegend | Cat# 103126 |
| anti-CD11b (clone M1/70) | Biolegend | Cat# 101230 |
| anti-CD11c (clone N418) | Biolegend | Cat# 117310 |
| anti-F4/80 (clone BM8) | Biolegend | Cat# 123114 |
| anti-CD19 (clone 1D3/CD19) | Biolegend | Cat# 152408 |
| anti-PDCA1 (clone 927) | Biolegend | Cat# 127014 |
| anti-B220 (clone RA3–6B2) | Biolegend | Cat# 103232 |
| anti-SiglecH (clone 551) | Biolegend | Cat# 129606 |
| anti-Ly6c (clone HK1.4) | Biolegend | Cat# 128005 |
| anti-ST2 (clone RMST2–2) | eBioscience | Cat# 46–9335-80 |
| anti-Foxp3 (clone FJK-16s) | eBioscience | Cat# 17–5773-82 |
| anti-TCR Vβ4 (clone KT4) | BD Biosciences | Cat# 553366 |
| anti-Thy1.1 (clone OX-7) | BD Biosciences | Cat# 561409 |
| anti-Thy1.2 (clone 53–2.1) | BD Biosciences | Cat#561641 |
| InVivoMAb anti-IFNAR1 (clone MAR1–5A3) | BioXCell | Cat# BE0241 |
| InVivoMAb IgG1 isotype control (clone MOPC-21) | BioXCell | Cat# BE0083 |
| InVivoMAb anti-PDCA1 (clone 927) | BioXCell | Cat# BE0311 |
| InVivoMAb IgG2b isotype control (clone LTF-2) | BioXCell | Cat# BE0090 |
| Chemicals, peptides, and recombinant proteins | ||
| Recombinant Human IL-2 | Peprotech | Cat# 200–02 |
| Recombinant mouse IL-33 (carrier-free) | Biolegend | Cat# 580506 |
| Recombinant Mouse IFN-α (carrier-free) | Biolegend | Cat# 752806 |
| Recombinant Mouse TNF-α (carrier-free) | Biolegend | Cat# 575206 |
| Recombinant Mouse IFN-γ (carrier-free) | Biolegend | Cat# 575306 |
| Insulin | Eli Lilly | Humulin R U-100 |
| D-Glucose | Thermo Fisher | Cat# D16–500 |
| Collagenase type II | Sigma | Cat# C6885 |
| 2-Mercaptoethanol | Sigma | Cat# M7522 |
| Diphtheria Toxin | Sigma | Cat# D0564 |
| Critical commercial assays | ||
| Foxp3 / Transcription Factor Staining Buffer Set | eBioscience | Cat# 00–5523-00 |
| TransIT®−293 Transfection Reagent | Mirus | Cat# MIR 2705 |
| Click-iT™ Plus EdU Pacific Blue™ Flow Cytometry Assay Kit | Invitrogen | Cat# C10636 |
| LIVE/DEAD™ Fixable Near-IR Dead Cell Stain Kit | Invitrogen | Cat# L10119 |
| Annexin V | Biolegend | Cat# 640920 |
| Annexin V Binding Buffer | Biolegend | Cat# 422201 |
| SuperScript™ III Reverse Transcriptase | Invitrogen | Cat# 18080093 |
| Dynabeads™ Untouched™ Mouse CD4 Cells Kit | Thermo Fisher | Cat# 11415D |
| Dynabeads™ Mouse T-Activator CD3/CD28 for T-Cell Expansion and Activation | Thermo Fisher | Cat# 11453D |
| RNeasy Lipid Tissue Mini Kit | Qiagen | Cat# 74804 |
| RNAClean XP beads | Beckman Coulter | Cat# A63987 |
| Nextera DNA Sample Prep Kit | Illumina | Cat# FC-121–1030 |
| Deposited data | ||
| RNA-Seq data | This paper | GSE174706 |
| Experimental models: Cell lines | ||
| Platinum-E Retroviral Packaging Cell Line | CELL BIOLABS | RV-101 |
| Experimental models: Organisms/strains | ||
| Mouse: vTreg53 TCR Tg / B6 | Li et al., 2018 | N/A |
| Mouse: Pparg-Tdt / B6 | Li et al., 2018 | N/A |
| Mouse: B6.CD45.1 | Jackson Laboratory | 002014 |
| Mouse: B6.CD45.2 | Jackson Laboratory | 000664 |
| B6.Foxp3-cre | Jackson Laboratory | 016959 |
| B6.Rosa26-Cas9 | Jackson Laboratory | 026179 |
| B6.Ifnar1fl | Jackson Laboratory | 028256 |
| Mouse: B6. Foxp3-GFP | Bettelli et al., 2006 | N/A |
| Mouse: B6. Foxp3-Thy1.1 | Liston et al., 2008 | N/A |
| Mouse: B6.Bdca2-Dtr | Swiecki et al., 2010 | N/A |
| Oligonucleotides | ||
| sgRNA targeting Ifnar1 sequence: 5’ CTTCTAAACGTACTTCTGGG 3’ | This paper | N/A |
| qPCR primer for Tbp FWD: 5’ ACCCTTCACCAATGACTCCTATG | This paper | N/A |
| qPCR primer for Tbp REV: 5’ TGACTGCAGCAAATCGCTTGG | This paper | N/A |
| qPCR primer for Ifna FWD: 5’ CCTGCTGGCTGTGAGGA | This paper | N/A |
| qPCR primer for Ifna REV: 5’ GGAAGACAGGGCTCTCCAG | This paper | N/A |
| Recombinant DNA | ||
| Plasmid: MSCV-Ctl-sg-GFP | This paper | N/A |
| Plasmid: MSCV-Ctl-sg-RFP | This paper | N/A |
| Plasmid: MSCV-Ifnar1-sg-GFP | This paper | N/A |
| Software and algorithms | ||
| Cuffquant version 2.2.1 | Trapnell et al., 2012; | http://cole-trapnell-lab.github.io/cufflinks/install/ |
| GenePattern software package | Broad Institute | http://software.broadinstitute.org/cancer/software/genepattern/ |
| R | The R Foundation | https://www.r-project.org |
| GSEA | Broad Institute | http://www.gsea-msigdb.org/gsea/index.jsp |
| PRISM | GraphPad | https://www.graphpad.com |
| FlowJo | FlowJo, LLC | https://www.flowjo.com |
| Other | ||
| NCD: Picolab Mouse Diet 20 with 13 kcal% Fat | Lab Diet | No. 5053 |
| HFD: Rodent Diet With 60 kcal% Fat | Research Diets | Cat#: D12492 |