Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primer and V5 sequences used to PCR amplify the pCCL-EF1α-V5-CFTR vector.
| V5-forward | ggatagcaccagcggcggcggcggcagcggcggcagcatgcagaggtcgcctctggaaaaggccag |
| V5-reverse | cgccgccgctggtgctatccaggcccagcagcgggttcggaatcggtttgcccatggtggcggtctctcacgacacctgaaatggaagaaaaaaactttgaaccactg |
